ID: 1025974576

View in Genome Browser
Species Human (GRCh38)
Location 7:66359507-66359529
Sequence AGGACCCATTTCTTCACACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 5, 2: 2, 3: 5, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025974571_1025974576 0 Left 1025974571 7:66359484-66359506 CCCCTGGACACTTTAAGAACCTT 0: 1
1: 4
2: 0
3: 13
4: 130
Right 1025974576 7:66359507-66359529 AGGACCCATTTCTTCACACGAGG 0: 1
1: 5
2: 2
3: 5
4: 74
1025974573_1025974576 -2 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974576 7:66359507-66359529 AGGACCCATTTCTTCACACGAGG 0: 1
1: 5
2: 2
3: 5
4: 74
1025974572_1025974576 -1 Left 1025974572 7:66359485-66359507 CCCTGGACACTTTAAGAACCTTA 0: 1
1: 4
2: 2
3: 7
4: 130
Right 1025974576 7:66359507-66359529 AGGACCCATTTCTTCACACGAGG 0: 1
1: 5
2: 2
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025974576 Original CRISPR AGGACCCATTTCTTCACACG AGG Intronic
913165820 1:116183487-116183509 AGCAGCCATTTCATGACACGAGG + Intergenic
915113659 1:153581689-153581711 AGGACCCATCTCTTCACGATTGG - Intergenic
919988210 1:202690453-202690475 AGGTCTCCTTTCTTCACAAGAGG + Intronic
923036517 1:230288426-230288448 GGCACCCATTTCATCACACAAGG + Intergenic
1064336706 10:14450024-14450046 GGGACCCATTTCTGTTCACGTGG - Intronic
1080971021 11:37277065-37277087 AGGCCACATGTCTTCACAGGGGG + Intergenic
1085703925 11:78769271-78769293 AGCACCCATGTCTTCAGACAAGG - Intronic
1086420012 11:86629473-86629495 AGGACACATTTCCTCCCACCAGG + Intronic
1088572270 11:111233924-111233946 AGGAACCAGTTCTTCACTGGTGG + Intergenic
1090331825 11:125938740-125938762 AGGAGTCCTTTCTTCACACCCGG + Intergenic
1093156864 12:15696707-15696729 AAGTCCCATTTCTTCCCAAGTGG - Intronic
1093181999 12:15977362-15977384 AGGAGTCATGTCTTCATACGTGG - Intronic
1101467174 12:104960051-104960073 AGGACCCAGTTTTTTACAAGGGG - Intergenic
1102078537 12:110079510-110079532 AATCCCCATTTCTTCACACGTGG - Intergenic
1104137328 12:125952877-125952899 AGGACCCATCTCCACACACATGG + Intergenic
1105461923 13:20599267-20599289 AAGTTCCATTTCTTCACAGGAGG + Intronic
1108025348 13:46171536-46171558 AGGACCCTTTTCTCCACCAGTGG - Intronic
1113412443 13:110102090-110102112 AGGACCCCTCCCTTCACAGGGGG + Intergenic
1121142413 14:91555055-91555077 TGGACCCATATCTTCTCACTGGG + Intergenic
1124371581 15:29107380-29107402 AGAACCCATTCCTTCGCAGGCGG - Intronic
1130821737 15:87503141-87503163 AGGACCCAAACCTTCACAGGAGG + Intergenic
1131701506 15:94942089-94942111 AGGACTCATTTCTTCTGACTTGG + Intergenic
1140138048 16:72225512-72225534 AGACCCCATGTCTTTACACGGGG + Intergenic
1140322229 16:73964236-73964258 ATGACCCATTTCTTGCCTCGAGG - Intergenic
1143316016 17:6034040-6034062 AGGACCATTTTCTTCACTTGTGG - Intronic
1144464814 17:15488824-15488846 AGGCCCCATTGCTGCACCCGAGG - Intronic
1152941719 17:83176296-83176318 AGGCTTCATTTCTTGACACGGGG + Intergenic
1153003557 18:477951-477973 AGAACCCATTTCTTCAGGCATGG - Intronic
1153973908 18:10249920-10249942 AGGAGCCCTTACTTCACAGGAGG - Intergenic
1155016747 18:21849335-21849357 ATGAGGCATTTCTTGACACGTGG - Exonic
1159332260 18:67011977-67011999 AGCACCCATTTATTAACACTTGG - Intergenic
1160157996 18:76448463-76448485 GGTACACATTTCTTCACACCGGG - Intronic
1161257227 19:3316123-3316145 AGGCCCCATTTCTCCATACGGGG + Intergenic
1168151326 19:54450335-54450357 AGAACCCATTTCTTCACGTTGGG + Intronic
936329591 2:111536328-111536350 AGGCCCCACTTCTTAACACTGGG + Intergenic
942764960 2:179444081-179444103 AGGATTGATTTCTTCACAGGAGG - Intronic
943064578 2:183072404-183072426 AGCAGCCATTTCTACACAAGTGG - Intergenic
946345894 2:219110184-219110206 AGAATCCATGTCTTCACATGGGG + Intronic
1168769910 20:408329-408351 AGGCCCCAGTTCTTCGCAAGGGG - Exonic
1170713735 20:18814558-18814580 ATCACCCATTTCTTTACACGTGG - Intronic
1181570963 22:23767682-23767704 ACGACCCACGTCTCCACACGTGG + Intronic
951500981 3:23386878-23386900 AGAACCCATATCTTCATACTTGG + Intronic
953455082 3:43034591-43034613 AGGACCCTTTTCTTCAACAGGGG - Intronic
959156293 3:102670091-102670113 AGGACACGTTTTTTCACATGGGG - Intergenic
959166590 3:102787408-102787430 ATGACCTATTGCTTCACACTTGG + Intergenic
964378122 3:156069523-156069545 GGGACCCAGTTCATCTCACGGGG - Intronic
970875078 4:20859923-20859945 AGGACTCATCTCTGCACACATGG - Intronic
974719481 4:65718867-65718889 AGAACAAATTTCTTCACACTTGG - Intergenic
979810254 4:125027954-125027976 ATGAGCCATTGCTTCACACATGG + Intergenic
982312678 4:154002308-154002330 AGTACCCATTACTACACAGGGGG + Intergenic
984386892 4:179072294-179072316 AGGACCCAATTCCTCACAGATGG + Intergenic
988529613 5:32016180-32016202 AGGCCTCATTTCTACACTCGAGG - Intronic
994298810 5:98121793-98121815 CTGACCCATTTCTTCTCACTGGG + Intergenic
996890216 5:128410243-128410265 AGGACCTAATTTTGCACACGTGG - Intronic
998659101 5:144216357-144216379 AGTATGAATTTCTTCACACGGGG - Intronic
999288497 5:150408247-150408269 AGGCCCCACTTCTTCCCAGGTGG - Intronic
1001527525 5:172439395-172439417 AGTTTCCATTTCTTCACACCTGG + Intronic
1002059182 5:176616431-176616453 TGGACCCATTTTTTCAGATGAGG - Intergenic
1013580293 6:111527349-111527371 AGGACCCATTTCCTCACAGGCGG - Intergenic
1017497142 6:154993042-154993064 TGGACCCATATGTACACACGTGG + Intronic
1019528134 7:1490056-1490078 AGGATCCGTTTCCTCACCCGAGG - Intronic
1025974490 7:66359072-66359094 AGGATCCATTTCTTCACGTGAGG + Intronic
1025974501 7:66359135-66359157 AGGACCCATTTCTTCACATGAGG + Intronic
1025974514 7:66359199-66359221 AGGACCCATTTCTTCACATGAGG + Intronic
1025974526 7:66359258-66359280 AGGACCCATTTCTTCACATGAGG + Intronic
1025974539 7:66359321-66359343 AGGACCCATTTCTTCACATGAGG + Intronic
1025974551 7:66359381-66359403 AGGACCCATTTCTTCACATGAGG + Intronic
1025974564 7:66359444-66359466 AGGACCCATTTCTTCACATAAGG + Intronic
1025974576 7:66359507-66359529 AGGACCCATTTCTTCACACGAGG + Intronic
1026121924 7:67545298-67545320 AGGACCCTTATGTTCACACTGGG - Intergenic
1026740117 7:72973954-72973976 AGCACCCAATTCTGCACACTGGG + Intergenic
1026797427 7:73375466-73375488 AGCACCCAATTCTGCACACTGGG + Intergenic
1027103616 7:75391116-75391138 AGCACCCAATTCTGCACACTGGG - Intergenic
1028885596 7:95929007-95929029 AGGACTCTTATCTTCAAACGAGG - Intronic
1034421955 7:150995249-150995271 ACCTCCCAGTTCTTCACACGAGG - Exonic
1036111318 8:5905878-5905900 TGGACTCATTTCTTCCCACTTGG - Intergenic
1036621485 8:10427147-10427169 AGGACCCATGTTTTCACGAGGGG - Intronic
1037598748 8:20375717-20375739 AGCACCCATTTTCTCACATGAGG - Intergenic
1038935367 8:32243879-32243901 AGGGCCCATTTCTTGGCATGTGG - Intronic
1044917315 8:97128931-97128953 AGGAGACATTTCTCCACAGGGGG + Intronic
1048503877 8:135003355-135003377 TGGACCCATTTCTGCATATGAGG - Intergenic
1049838177 8:144753850-144753872 AGGGCCCATCTCTCCACACCTGG - Intronic
1058886629 9:109326627-109326649 AGGACCCATTTCTTCCCCAGAGG + Intergenic
1059655391 9:116352992-116353014 AGCACTCATTTCTTCACTGGAGG + Intronic
1194948763 X:100099614-100099636 AGGACCCATTTCATCTTTCGAGG + Intergenic
1195502429 X:105617457-105617479 AAGCCCCATTTCTTCAGACATGG + Intronic
1201482591 Y:14455829-14455851 AGTACCTAGTTCTTCACACTGGG - Intergenic