ID: 1025974580

View in Genome Browser
Species Human (GRCh38)
Location 7:66359528-66359550
Sequence GGAATCATGGTGCTGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 2, 2: 5, 3: 18, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025974578_1025974580 -7 Left 1025974578 7:66359512-66359534 CCATTTCTTCACACGAGGAATCA 0: 1
1: 1
2: 0
3: 14
4: 163
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146
1025974573_1025974580 19 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146
1025974571_1025974580 21 Left 1025974571 7:66359484-66359506 CCCCTGGACACTTTAAGAACCTT 0: 1
1: 4
2: 0
3: 13
4: 130
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146
1025974577_1025974580 -6 Left 1025974577 7:66359511-66359533 CCCATTTCTTCACACGAGGAATC 0: 1
1: 1
2: 2
3: 7
4: 138
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146
1025974575_1025974580 2 Left 1025974575 7:66359503-66359525 CCTTAGGACCCATTTCTTCACAC 0: 1
1: 6
2: 1
3: 13
4: 154
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146
1025974572_1025974580 20 Left 1025974572 7:66359485-66359507 CCCTGGACACTTTAAGAACCTTA 0: 1
1: 4
2: 2
3: 7
4: 130
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025974580 Original CRISPR GGAATCATGGTGCTGACCCC TGG Intronic
901732541 1:11290597-11290619 GGAAGCTTGGTGCTGACTTCTGG + Intronic
902217631 1:14944663-14944685 TGAGTCATGGTGCTGTTCCCGGG + Intronic
904611474 1:31728311-31728333 GGGATCATGGTGCTGCCCCGGGG - Intronic
907317204 1:53580055-53580077 GGAATCAAGATTCTGATCCCAGG - Intronic
909514136 1:76488379-76488401 GGAAGCATGGTGCTAGCGCCTGG - Intronic
910969968 1:92846059-92846081 GGCCTCCTGGTGCTTACCCCAGG + Intronic
912486749 1:110034983-110035005 GGACTCATGCTCCAGACCCCAGG - Intronic
912796180 1:112694915-112694937 GGAATCAGAGTGCAGGCCCCAGG - Intronic
918734363 1:188039256-188039278 GGAAACATGGTGCTGGCACAAGG + Intergenic
920560245 1:206933502-206933524 GGTATGATAGTGCTGCCCCCTGG + Intronic
922222771 1:223621087-223621109 GGAATTGTCGTGCTGACCCCCGG - Intronic
922225633 1:223643791-223643813 TGAATTATGGTGCGGACCCTGGG - Intronic
924808155 1:247378238-247378260 CAAAGCATGGTGCTGATCCCTGG + Intergenic
1064244465 10:13657713-13657735 GGAATCATGGTGGAGACCCCAGG - Intronic
1064747462 10:18492003-18492025 GGAATCATGGTGTTGGCATCTGG + Intronic
1065407717 10:25388484-25388506 GGACTCATGGGGCTGGCCCCAGG + Intronic
1069511000 10:69042511-69042533 GGAAACAGGCTGCTGACACCCGG + Intergenic
1071361855 10:84854783-84854805 AGAAGCATGGTGGTGGCCCCAGG - Intergenic
1072637186 10:97185658-97185680 GGCACCATGGCGCTGACTCCCGG - Exonic
1075516879 10:123116522-123116544 GCAATCATGGAGTTGACCCCAGG - Intergenic
1075572545 10:123556625-123556647 GGAAACACAGTGCAGACCCCTGG + Intergenic
1076406475 10:130215420-130215442 GTAATCTTGCAGCTGACCCCTGG - Intergenic
1079904738 11:26231269-26231291 GGAAGCATGGTCCTGACCATAGG - Intergenic
1081526795 11:43933171-43933193 GGAATCATGGTACTGGCTCATGG + Intronic
1082807469 11:57460133-57460155 GGAATCTTGGAGCTGTCCCAGGG + Intergenic
1083610087 11:64000391-64000413 GGACTGAGGGTGCTCACCCCGGG - Intronic
1084450777 11:69235325-69235347 GGAGGCATGGTGATGACCACAGG - Intergenic
1085563593 11:77492947-77492969 GGAAGCATGGTGCTGAAATCTGG - Intergenic
1086282434 11:85206225-85206247 GGAAGCATGATGCTGGCACCTGG - Intronic
1086834341 11:91601989-91602011 GGAATCATTGTTGTGTCCCCCGG - Intergenic
1087169251 11:95033729-95033751 GGAATTATTGTTGTGACCCCTGG + Intergenic
1089625804 11:119750127-119750149 GGAATCCTGGTTCTGTTCCCAGG + Intergenic
1090278139 11:125433761-125433783 GGGATTATGGTGCTGATCCCTGG - Intergenic
1091172169 11:133528941-133528963 TGCATCATGGTGCTGGCCCCTGG + Intronic
1095939317 12:47715920-47715942 TGAAACATGGTGCTGACTCCAGG + Intronic
1096503519 12:52079669-52079691 GGAACCAAGGGGCGGACCCCAGG - Intergenic
1096639710 12:52984355-52984377 TTAATCATGGTGCAGATCCCAGG - Intergenic
1100818689 12:98410548-98410570 AAAATCATGGTGCTGACATCTGG - Intergenic
1103844522 12:123892225-123892247 GGAAGCATGGTGCTGATTTCTGG + Intronic
1104046670 12:125168114-125168136 GTGATCCTGGAGCTGACCCCTGG - Intergenic
1107942146 13:45384174-45384196 AGAATCACAGTGCAGACCCCTGG - Intergenic
1107994297 13:45845916-45845938 GGTGTCATGCTGCTGGCCCCAGG + Intronic
1113579128 13:111416461-111416483 AAAATCAAAGTGCTGACCCCCGG + Intergenic
1114189234 14:20428481-20428503 GGAAAAATGGTTCTGACCCATGG - Intergenic
1114383273 14:22231425-22231447 GGAAGCATGGTGCTGGCATCTGG + Intergenic
1114383552 14:22233456-22233478 GGAAGCATGGTGCTGGCATCTGG + Intergenic
1121460933 14:94077573-94077595 GGAATAATGGTACTTACCCCAGG + Intronic
1122939288 14:104973995-104974017 GGAAACATGGAGCTGAGCCCAGG - Intronic
1123199352 14:106647383-106647405 GGAATCATGGTCCAGTCCTCAGG + Intergenic
1124988392 15:34645864-34645886 GGATTCATGGTCCTCAACCCTGG + Intergenic
1125481401 15:40083505-40083527 GGAATCATGGGGCAGAACCCTGG + Intergenic
1126192208 15:45889553-45889575 GGAAGCCTGGAGCTGACTCCAGG - Intergenic
1127386066 15:58468211-58468233 TGAATCATGGACCTGAACCCAGG + Intronic
1129434067 15:75523579-75523601 GAAATCATGGTCCTGTTCCCTGG - Intronic
1131698892 15:94910778-94910800 GGCATCCTGCTGCTGGCCCCGGG + Intergenic
1132691360 16:1183195-1183217 GGAATCCTGGGGCTGCCCTCGGG + Intronic
1133189287 16:4121653-4121675 GGAATAATGGTGAGGAGCCCAGG + Intergenic
1133773329 16:8880410-8880432 GGAAGCCCGGTGCTGCCCCCTGG + Intergenic
1134201727 16:12204905-12204927 GGAATCACTGGGCTCACCCCAGG - Intronic
1137591600 16:49697103-49697125 GGAAGCAAGGTCCTGAGCCCTGG - Intronic
1138389595 16:56660686-56660708 GCAAGCATGGTCCTGACTCCTGG - Intronic
1138858853 16:60730406-60730428 GTACTCATGGTGCTGTCTCCAGG + Intergenic
1140214252 16:72994746-72994768 GGAACCTTGGTGCTGAGCACTGG - Intronic
1140258177 16:73354816-73354838 GGAATCTTGGGGCTGATGCCGGG - Intergenic
1141619923 16:85231884-85231906 GTCATCATGGTGCTGGCCTCTGG + Intergenic
1142434125 16:90046519-90046541 TGAATTATGGTGCTGGCCCACGG + Intergenic
1144781866 17:17812410-17812432 GCCATGATGGTGCTGACCTCTGG - Exonic
1147880041 17:43647576-43647598 GCAAACAGGGTGGTGACCCCAGG - Intronic
1151784192 17:76267036-76267058 GGGAGCATGGTGCTGGCCACAGG + Intronic
1155182815 18:23362842-23362864 GGAATCTTGGTGATTATCCCAGG - Intronic
1157307975 18:46530759-46530781 GGAATAATGCTGCAGAACCCAGG - Intronic
1157516295 18:48314034-48314056 GGAAGCACGGTGCTGGCCTCTGG - Intronic
1160710333 19:548507-548529 GGAATCAGGGTGCTGCGGCCTGG - Intronic
1161169840 19:2807236-2807258 GCAAGCATGGGACTGACCCCAGG - Intronic
1161285732 19:3467417-3467439 GGAACCCAGGTTCTGACCCCAGG + Intronic
1162930442 19:13954769-13954791 GGAATCTTGATGATGACCCCAGG - Intronic
1163786937 19:19279613-19279635 TGACTCAGGGTCCTGACCCCTGG + Intronic
1166259164 19:41626126-41626148 GGGGTCATGCTGCTGACCCAGGG - Intronic
1166631912 19:44414418-44414440 GAAATCATGGTTCTCAACCCAGG + Intergenic
1166901370 19:46066570-46066592 GGAAGCATGGTGCTGGCATCTGG + Intronic
1168548419 19:57273043-57273065 GGCATCATGATGCTGAGCACTGG - Intergenic
925343027 2:3149743-3149765 GTACTCAAGGTGCTGACTCCTGG + Intergenic
928359315 2:30649913-30649935 AGAATCATGGTCCTCAGCCCTGG + Intergenic
930767001 2:55094755-55094777 GGAACCATGGTGCTAACATCAGG + Intronic
931432446 2:62218965-62218987 GGAATAAGCTTGCTGACCCCTGG - Intronic
932242297 2:70166935-70166957 GCATTCATGGTGCTGACCATCGG - Intronic
932903854 2:75729239-75729261 GAAACCATGTTGCTGTCCCCTGG + Intergenic
934609124 2:95721721-95721743 GGGCTCATGCTGCTGACCCAGGG - Intergenic
935347353 2:102121072-102121094 GTCATCATGGAGCTGGCCCCCGG + Intronic
936679709 2:114756371-114756393 GGAATCATGGAGATGATCCAAGG + Intronic
939003852 2:136764792-136764814 GGAAACATTGTGGTGACTCCGGG - Intergenic
942526246 2:176856199-176856221 GGAATTGGGGTGCTGACCCCTGG - Intergenic
943876317 2:193071974-193071996 GGAAGCATGGTGCTGGCATCTGG - Intergenic
946609127 2:221439174-221439196 GGAATCTTGGTGCAGACCAAAGG + Intronic
1168871002 20:1128380-1128402 GGAATCAGGGTTCTCACCACAGG - Intronic
1175500162 20:59444355-59444377 GGAGCCAGGCTGCTGACCCCTGG - Intergenic
1175937866 20:62523183-62523205 CGAGTCATGGTGGTGGCCCCAGG - Intergenic
1178940696 21:36902565-36902587 GGAATCCTGGTGCTGGCAGCCGG + Intronic
1182659676 22:31916418-31916440 GGGATCATGGTGAGGACCCGAGG + Intergenic
1184321203 22:43743464-43743486 GGAATCAGGCTGCTTTCCCCAGG - Intronic
1185185703 22:49398378-49398400 GGCATCACAGTGCTGGCCCCGGG - Intergenic
949756818 3:7421691-7421713 GGACTCTTGGTCCTGACCTCAGG + Intronic
952650549 3:35721765-35721787 GGCATCACGGTGCTGACCAGGGG + Exonic
954692734 3:52404296-52404318 GGCATGATGGGGCTGACCCCAGG - Intronic
956033114 3:65060948-65060970 GGAATCATGGAACTGCCCGCAGG - Intergenic
957145608 3:76419756-76419778 GGAATCATGTAGCTGAATCCTGG + Intronic
958735757 3:98007641-98007663 GGAATGATGGTGCTGGCCAAAGG + Intronic
960049401 3:113225744-113225766 GGAATCAGGGTGCAGTCTCCTGG + Intronic
963331594 3:143921804-143921826 GGAATCATTGTTCTGTCTCCTGG + Intergenic
967907883 3:194516783-194516805 GGAATGCTGGTGCTGACACCAGG - Intergenic
968619509 4:1597458-1597480 GGAACCATGCTGCTGGGCCCAGG + Intergenic
969673397 4:8601892-8601914 AGAACCATAGTGCTTACCCCTGG + Intronic
970590997 4:17560636-17560658 TGAGCCATGGTGCTGGCCCCAGG - Intergenic
972934588 4:44117481-44117503 TGAACCATGGTTCTGACCGCAGG + Intergenic
973959795 4:56098641-56098663 GGAAACAAGGTGTTAACCCCTGG - Intergenic
975139235 4:70902800-70902822 GGAATCCAGGCGCTGGCCCCGGG - Intronic
980875000 4:138652516-138652538 GGAAGCATGGTGCTGGCATCTGG - Intergenic
982204567 4:152988246-152988268 GGGATCAGTGTGATGACCCCAGG - Intergenic
986184476 5:5422901-5422923 GGCATCATGGTGCCGCCGCCGGG - Exonic
986586640 5:9324858-9324880 GGAATAATGCTTCTGGCCCCTGG + Intronic
991173730 5:63660090-63660112 GGAAGCATGGTGCTGGCATCTGG - Intergenic
995183588 5:109250495-109250517 GGAAACATGGTGCTTCCCCAAGG + Intergenic
995190416 5:109313658-109313680 GGAGTGGTGGTGATGACCCCTGG - Intergenic
998672196 5:144366653-144366675 GGACACATAGTGCAGACCCCAGG - Intronic
999615088 5:153414526-153414548 GGGATCATGGGGCAGAACCCAGG - Intergenic
1004777480 6:18863933-18863955 GGAAGCATGGTGCTAGCACCTGG - Intergenic
1009730564 6:67598792-67598814 GGAATGATGGCGATAACCCCTGG - Intergenic
1013588850 6:111603288-111603310 GGAATCAAGAAGCTGCCCCCCGG - Intronic
1013905944 6:115219930-115219952 GGAATCATTATGATTACCCCTGG - Intergenic
1014290254 6:119550244-119550266 GGAATCATGTTACTGGCTCCTGG + Intergenic
1015624231 6:135163450-135163472 TGAATCAGGGTGCTGCCTCCTGG - Intergenic
1019522559 7:1467360-1467382 GGAATGACGGTGCCGACCCCAGG - Intergenic
1022960452 7:35421256-35421278 AGAGTCATGGTGCAGACCCATGG - Intergenic
1024348816 7:48341377-48341399 GGAATCATGGTATCCACCCCAGG - Intronic
1024610592 7:51060756-51060778 GGAATCATTGTTGTGCCCCCTGG - Intronic
1025974495 7:66359096-66359118 GGAATCAGGGTGCTGACCCCTGG + Intronic
1025974507 7:66359159-66359181 GGAATCAGGGTGCTGACCCCTGG + Intronic
1025974520 7:66359223-66359245 GGAATCAGGGTCTTGACCCCTGG + Intronic
1025974532 7:66359282-66359304 GGAATCAGGGTGCTGCCCCCTGG + Intronic
1025974544 7:66359342-66359364 GGAATCAGGGTGCTGCCCCCTGG + Intronic
1025974557 7:66359405-66359427 GGAATCAGGGTGCTGCCCCCTGG + Intronic
1025974570 7:66359468-66359490 GGAATCAGGGTCTTGACCCCTGG + Intronic
1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG + Intronic
1036141988 8:6217161-6217183 GGAAGCATGGTGCTGGCATCTGG - Intergenic
1036473363 8:9070892-9070914 GGAATCATGGTGGTGGCCCCAGG + Intronic
1041439245 8:57875869-57875891 GGGGTCAGGGTCCTGACCCCTGG - Intergenic
1042391329 8:68239119-68239141 GGAATCTTGAGGCTGACCCTAGG - Intergenic
1046128430 8:109939779-109939801 GGAATCATTGTTGTGTCCCCTGG + Intergenic
1046319945 8:112559489-112559511 GTATTCATGGTGTTGCCCCCAGG + Intronic
1046929529 8:119828263-119828285 GGAATCATGGTTATGTGCCCTGG - Intronic
1049432582 8:142572109-142572131 GGGCTCTTGATGCTGACCCCAGG - Intergenic
1049457028 8:142698532-142698554 GGAAGCATGGTGCTGGCTTCTGG + Intergenic
1049602407 8:143514042-143514064 GGTAGCCTGGTGCTCACCCCTGG + Intronic
1055101922 9:72474758-72474780 GTAATCATGGTGCTTACACAGGG + Intergenic
1055971300 9:81915418-81915440 GGTATCATGATGCTGACCCAGGG - Intergenic
1055973021 9:81930481-81930503 GGTATCATGATGCTGGCCCAGGG - Intergenic
1055974774 9:81945573-81945595 GGTATCATGATGCTGGCCCAGGG - Intergenic
1056963981 9:91150831-91150853 AGAACCATCCTGCTGACCCCAGG + Intergenic
1059251186 9:112889487-112889509 TGCATCATGGGGCTGACACCAGG - Intronic
1059951239 9:119464535-119464557 GGAATAATGATGCTTATCCCTGG + Intergenic
1061193501 9:129095314-129095336 GGAACCAAGGAGCTGAGCCCTGG + Exonic
1062135741 9:134926918-134926940 GGAATCATTGTGGTGTCTCCTGG - Intergenic
1186560002 X:10601566-10601588 TGAACAAGGGTGCTGACCCCTGG + Intronic
1186700773 X:12087450-12087472 TGAATCTTGATGCTGACCCTGGG - Intergenic
1187731039 X:22255114-22255136 GTAATCATGGGGCTGATCACAGG - Intergenic
1189646373 X:43137212-43137234 GGAATCACGGGGATGACCCTAGG - Intergenic
1190055197 X:47177411-47177433 GGAATCACAATGCTGGCCCCAGG - Intronic
1190625162 X:52330293-52330315 GGAATCATTGTGGTGTCTCCTGG + Intergenic
1192896485 X:75447793-75447815 GGAATCATTGTTGTGTCCCCTGG - Intronic
1195698209 X:107682522-107682544 GGTATCCTGGGGCTGAACCCAGG - Intergenic
1197947323 X:131853314-131853336 GGAATAATGGAGTTTACCCCAGG - Intergenic
1198496136 X:137195496-137195518 GGAATCATTTTGCTGAGCCTTGG + Intergenic