ID: 1025974581

View in Genome Browser
Species Human (GRCh38)
Location 7:66359536-66359558
Sequence GGTGCTGACCCCTGGACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025974573_1025974581 27 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data
1025974571_1025974581 29 Left 1025974571 7:66359484-66359506 CCCCTGGACACTTTAAGAACCTT 0: 1
1: 4
2: 0
3: 13
4: 130
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data
1025974578_1025974581 1 Left 1025974578 7:66359512-66359534 CCATTTCTTCACACGAGGAATCA 0: 1
1: 1
2: 0
3: 14
4: 163
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data
1025974572_1025974581 28 Left 1025974572 7:66359485-66359507 CCCTGGACACTTTAAGAACCTTA 0: 1
1: 4
2: 2
3: 7
4: 130
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data
1025974575_1025974581 10 Left 1025974575 7:66359503-66359525 CCTTAGGACCCATTTCTTCACAC 0: 1
1: 6
2: 1
3: 13
4: 154
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data
1025974577_1025974581 2 Left 1025974577 7:66359511-66359533 CCCATTTCTTCACACGAGGAATC 0: 1
1: 1
2: 2
3: 7
4: 138
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025974581 Original CRISPR GGTGCTGACCCCTGGACATC TGG Intronic
No off target data available for this crispr