ID: 1025980617

View in Genome Browser
Species Human (GRCh38)
Location 7:66402283-66402305
Sequence GGTGCTGCTGAGCACCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025980613_1025980617 9 Left 1025980613 7:66402251-66402273 CCAGGCAGGTGCAGAGAAACTGC 0: 2
1: 0
2: 7
3: 28
4: 254
Right 1025980617 7:66402283-66402305 GGTGCTGCTGAGCACCGTGCAGG No data
1025980612_1025980617 10 Left 1025980612 7:66402250-66402272 CCCAGGCAGGTGCAGAGAAACTG 0: 2
1: 0
2: 7
3: 60
4: 340
Right 1025980617 7:66402283-66402305 GGTGCTGCTGAGCACCGTGCAGG No data
1025980611_1025980617 13 Left 1025980611 7:66402247-66402269 CCACCCAGGCAGGTGCAGAGAAA 0: 2
1: 0
2: 3
3: 38
4: 271
Right 1025980617 7:66402283-66402305 GGTGCTGCTGAGCACCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025980617 Original CRISPR GGTGCTGCTGAGCACCGTGC AGG Intronic
No off target data available for this crispr