ID: 1025982941

View in Genome Browser
Species Human (GRCh38)
Location 7:66422267-66422289
Sequence CTTTCATGGCAGATGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025982941_1025982948 -9 Left 1025982941 7:66422267-66422289 CCTTGGCCCATCTGCCATGAAAG No data
Right 1025982948 7:66422281-66422303 CCATGAAAGACAACGTGTGGGGG 0: 2
1: 0
2: 1
3: 10
4: 104
1025982941_1025982946 -10 Left 1025982941 7:66422267-66422289 CCTTGGCCCATCTGCCATGAAAG No data
Right 1025982946 7:66422280-66422302 GCCATGAAAGACAACGTGTGGGG 0: 2
1: 0
2: 0
3: 9
4: 108
1025982941_1025982949 4 Left 1025982941 7:66422267-66422289 CCTTGGCCCATCTGCCATGAAAG No data
Right 1025982949 7:66422294-66422316 CGTGTGGGGGACAGATACATTGG No data
1025982941_1025982951 16 Left 1025982941 7:66422267-66422289 CCTTGGCCCATCTGCCATGAAAG No data
Right 1025982951 7:66422306-66422328 AGATACATTGGGCAGTGCACAGG No data
1025982941_1025982950 5 Left 1025982941 7:66422267-66422289 CCTTGGCCCATCTGCCATGAAAG No data
Right 1025982950 7:66422295-66422317 GTGTGGGGGACAGATACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025982941 Original CRISPR CTTTCATGGCAGATGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr