ID: 1025987465

View in Genome Browser
Species Human (GRCh38)
Location 7:66466243-66466265
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 2, 1: 0, 2: 4, 3: 37, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025987456_1025987465 18 Left 1025987456 7:66466202-66466224 CCATAGCAAAGAATGTCCTGTGA No data
Right 1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG 0: 2
1: 0
2: 4
3: 37
4: 285
1025987457_1025987465 2 Left 1025987457 7:66466218-66466240 CCTGTGAGAGCCTTGAGCGAATT No data
Right 1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG 0: 2
1: 0
2: 4
3: 37
4: 285
1025987458_1025987465 -8 Left 1025987458 7:66466228-66466250 CCTTGAGCGAATTACGAAACCTG No data
Right 1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG 0: 2
1: 0
2: 4
3: 37
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025987465 Original CRISPR GAAACCTGGGGGCAGCCCTG GGG Intergenic
900114892 1:1024220-1024242 GAAGCCTGGGGTGAGCCCTGAGG + Intronic
900392405 1:2439371-2439393 AGAACCCGGGGGCAGCCCTGGGG - Intronic
900641164 1:3688678-3688700 GAAAGCTGGGTGCCGCTCTGGGG + Intronic
900932473 1:5745976-5745998 GACCCCTGGTGGCAGCCATGGGG + Intergenic
901131954 1:6967444-6967466 CAATCCTGGAGTCAGCCCTGAGG - Intronic
901369994 1:8788913-8788935 GCACCCTGGGCACAGCCCTGAGG + Intronic
901541765 1:9922342-9922364 GTAACTTGGGGGCCGTCCTGGGG + Intronic
901650009 1:10737870-10737892 GAAGGCTGGGCACAGCCCTGTGG + Intronic
902374987 1:16026414-16026436 GCTACCTGAGGACAGCCCTGGGG + Intronic
903121289 1:21218394-21218416 GACACCTGGGGGCTGCACTGCGG + Intronic
903212020 1:21823892-21823914 GAAACCTGGGTGCAGAAATGAGG - Exonic
903215612 1:21841954-21841976 GCAAGCTGGGGGCAGGCATGGGG - Intronic
903986708 1:27234368-27234390 GAAAGCTGGGCTAAGCCCTGGGG - Intergenic
904927528 1:34060501-34060523 GCAGCCTGGGGGGAGCTCTGAGG + Intronic
905199613 1:36307003-36307025 GGGACCTCGGGGCCGCCCTGCGG + Intronic
905633278 1:39530946-39530968 GGAGCCAGTGGGCAGCCCTGGGG + Intergenic
905892199 1:41524528-41524550 GATGGCTGGGGGCAGCCATGGGG + Intronic
907869424 1:58429954-58429976 AAGACCTGGGGGATGCCCTGTGG - Intronic
910558417 1:88563067-88563089 GAAACCTGTGGGGACTCCTGAGG - Intergenic
912199821 1:107444109-107444131 CACAACTGGGGGCAACCCTGGGG - Intronic
913239028 1:116811967-116811989 CAAACCTGGGGGTAGTCTTGGGG + Intergenic
913961003 1:143338171-143338193 GAAACCAGGAGGCATCCTTGTGG + Intergenic
914123789 1:144802618-144802640 GAAACCAGGAGGCATCCTTGTGG - Intergenic
914449892 1:147781886-147781908 GAAACCTGGGGACTTCCCTGAGG + Intergenic
917649594 1:177063559-177063581 GAAACCTGTGGGCATGTCTGTGG + Intronic
917702522 1:177595629-177595651 GAAAGCTGGGGGCGTGCCTGAGG - Intergenic
918101698 1:181382048-181382070 GAAGCCTGGGGACAGCCCCTAGG + Intergenic
919039203 1:192360751-192360773 GTAAACTGGAGGAAGCCCTGTGG - Intronic
920196245 1:204229045-204229067 CCAACCTGGAGGCAGCCCTGCGG - Exonic
922215568 1:223516827-223516849 AGAGCCTGTGGGCAGCCCTGGGG + Intergenic
922568431 1:226617271-226617293 GAAACATGAGGGCTGCGCTGGGG - Intergenic
1062881671 10:983593-983615 GAAGCCTGGGAGCAGCTCTCTGG + Intergenic
1066294452 10:34042139-34042161 GAAACCTGGAGGCAGCTTAGTGG + Intergenic
1067203467 10:44194546-44194568 GAAAGCTGGGGTCAGCCCCAGGG + Intergenic
1067274558 10:44822106-44822128 CAGCCCTGGGGGCAGCCCTGTGG - Intergenic
1068636152 10:59350463-59350485 CAGACCTGGGGGCAGCCTTTGGG + Intronic
1069636948 10:69930659-69930681 GAAACCTGGGGCCAGGGCTTAGG + Intronic
1069943844 10:71972867-71972889 GGGACCTGTGGGCAGCCATGGGG - Intronic
1070954628 10:80455607-80455629 GAAACCTGGGGACAGGCCATCGG + Intronic
1070964992 10:80524428-80524450 GGAACCTGGGGGCAGTGCTGGGG + Exonic
1072762634 10:98069702-98069724 GAAAGCTGGGGTCAGCCCAAAGG - Intergenic
1073667027 10:105545102-105545124 GAAACCTGGGGAAAGGCTTGTGG - Intergenic
1074773490 10:116748901-116748923 GGTTCCTGGTGGCAGCCCTGTGG + Intergenic
1075031140 10:119025519-119025541 GAAACATGAGGTCAGCCCTGGGG - Intergenic
1075732279 10:124643741-124643763 TGCTCCTGGGGGCAGCCCTGTGG - Intronic
1075782453 10:125026225-125026247 AAGACCTGGGGGCTGCCGTGAGG + Exonic
1076156093 10:128206913-128206935 CAAACCTGGGGGCAGGGCTAAGG - Intergenic
1076354001 10:129839382-129839404 GAGGCCTGGGGGCACCCATGTGG + Intronic
1076412584 10:130262516-130262538 GAGCCATGGGGGCAGGCCTGCGG + Intergenic
1076482206 10:130792173-130792195 GAGGCCTGGGGCCAGCCCAGGGG - Intergenic
1076632171 10:131857807-131857829 GAAGCCTGGGTGCACGCCTGGGG + Intergenic
1076670094 10:132115820-132115842 TCAACCTTGGAGCAGCCCTGAGG + Intronic
1076686068 10:132199017-132199039 GCCTCCTGGGTGCAGCCCTGGGG + Intronic
1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG + Intronic
1077065247 11:638145-638167 GAACCCTGGGGGGAAGCCTGAGG + Intronic
1077325873 11:1963893-1963915 GAAACCTGAACGCATCCCTGAGG + Intronic
1077378459 11:2216391-2216413 GGGGCCTGGGAGCAGCCCTGGGG - Intergenic
1077460725 11:2708038-2708060 GAAACAGGGGAACAGCCCTGAGG - Intronic
1077638538 11:3860513-3860535 GAAAGCTGTGGGAAGCCCAGAGG + Intronic
1078145122 11:8717233-8717255 GACACCTGGAGCCAGTCCTGTGG - Intronic
1078929970 11:15905465-15905487 CCAGCCTGGGGGCAGCTCTGTGG - Intergenic
1080590546 11:33719742-33719764 CAGAGCTGGCGGCAGCCCTGGGG + Intronic
1081625578 11:44653375-44653397 TATAACTGTGGGCAGCCCTGGGG + Intergenic
1083310715 11:61782277-61782299 GTACCCTGGGGGCTGCGCTGGGG + Intronic
1083811301 11:65108325-65108347 GAAACCTGGAGGCCGAGCTGGGG + Exonic
1084007461 11:66330998-66331020 GCAACCTGGGGACAGCGCAGGGG - Intronic
1084040461 11:66539634-66539656 ACAACCTGCAGGCAGCCCTGGGG - Exonic
1084974105 11:72787298-72787320 GAACCCTGGGAGCTGCCCTCTGG + Intronic
1086968373 11:93053879-93053901 GAAAGCTGGGGGCAGCCCCGTGG - Intergenic
1088230480 11:107669163-107669185 CAAAACTGTGGGCAGTCCTGAGG - Intergenic
1089127008 11:116183575-116183597 GAACCCTGGGGGCAGCCTCCAGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091295591 11:134472058-134472080 ATACCCTGGGAGCAGCCCTGTGG + Intergenic
1202808853 11_KI270721v1_random:19072-19094 GAAACCTGAACGCATCCCTGAGG + Intergenic
1091406642 12:213539-213561 GAAACCTCGGGGCATTCCCGAGG - Intronic
1095908065 12:47397603-47397625 GAAACTTGGTGGCAGCCCACTGG + Intergenic
1096123907 12:49105993-49106015 GACATCAGGGGGCAGCTCTGAGG + Intronic
1097007157 12:55927737-55927759 GGAAGCTGCCGGCAGCCCTGCGG - Exonic
1098239615 12:68453459-68453481 GAAATGTGGGGGCAGTCCTTAGG - Intergenic
1100607820 12:96166128-96166150 GAAACCAGGGAGCAGCTTTGGGG + Intergenic
1102035054 12:109766260-109766282 GAAAGCTGTGGGCTGCCCTTGGG + Intronic
1102212657 12:111138526-111138548 GAACCCTGGGGGCTGCCATGGGG - Intronic
1102231250 12:111264011-111264033 GGAAGATGGGGGGAGCCCTGGGG - Intronic
1103928223 12:124435465-124435487 GGAAGCTGCGGGCAGCCCTCGGG - Intronic
1103936825 12:124481452-124481474 GAGACCTGTGGCTAGCCCTGTGG - Intronic
1104063246 12:125285670-125285692 GAGACCTGGGAGCAGCCCCAAGG - Intronic
1106135114 13:26968017-26968039 CAGAGCTGGGGGCAGCCCTGCGG - Intergenic
1108040933 13:46338703-46338725 GAAAAGAGGGGGCAGCCCTGGGG + Intergenic
1109052315 13:57499617-57499639 GAAAACTGGGGGCAGGGGTGGGG + Intergenic
1110470699 13:75856439-75856461 GAAAGCTTGGGGCACTCCTGGGG - Intronic
1111956554 13:94765344-94765366 GAAACCTGAGGGAAGCCTTAAGG + Intergenic
1112234326 13:97621832-97621854 GTAGCCTGGGGCCTGCCCTGGGG + Intergenic
1113532316 13:111037213-111037235 GACTCATGGGGGCAGCTCTGGGG + Intergenic
1113764283 13:112871103-112871125 GAAGCCTGGGGGCTTCCCTCGGG - Intronic
1113961207 13:114127274-114127296 GGACCCCGGAGGCAGCCCTGGGG - Intronic
1114241671 14:20874054-20874076 GAAACCTAGGGCCAGCCATCAGG + Intergenic
1116694059 14:48150000-48150022 GAAACTTGGGGGCTTCCATGTGG + Intergenic
1117434148 14:55700287-55700309 TAAAGCTCGGGGCAGCCGTGGGG + Intronic
1118121430 14:62848497-62848519 GATACTTGGGGGCAGCTATGTGG - Intronic
1121730278 14:96182018-96182040 GGAAGCTGGGGGGAGACCTGGGG - Intergenic
1122948995 14:105030370-105030392 GACTCCTGGGGCCAACCCTGGGG + Intergenic
1122996486 14:105268052-105268074 GAGCCCTGGGGCCAGCACTGTGG - Intronic
1124611972 15:31215416-31215438 GATACCTGGCAGCAGCCCTGCGG - Intergenic
1125509843 15:40286981-40287003 AAAATCTGGGGGCTGCCCAGTGG + Intronic
1129072432 15:72962390-72962412 GAAACCTAGGGGCAGCCACTGGG - Intergenic
1129778798 15:78255487-78255509 GGAACCAGAGGGCAGACCTGGGG - Intergenic
1130319265 15:82826619-82826641 GCAGCCTGGGCGCAGCCTTGGGG + Intronic
1132375356 15:101325096-101325118 GAAACAAAGGGGCAGGCCTGGGG - Intronic
1132463967 16:69120-69142 GCAACAAGAGGGCAGCCCTGGGG + Intronic
1132592052 16:730327-730349 GAATTTTGGGGGAAGCCCTGGGG + Exonic
1132658198 16:1049967-1049989 TACCCCTGGAGGCAGCCCTGGGG + Intergenic
1132671446 16:1103680-1103702 GCAACCTGAGGGCTGCCCAGGGG - Intergenic
1133702731 16:8324347-8324369 GAATCATGGGGGCAGGCCTTTGG + Intergenic
1133743361 16:8668421-8668443 GAAAGCTGGAGGCAGCCCTTGGG + Intergenic
1135937157 16:26791290-26791312 GAAACCTGGGCGGAGCCCAGTGG - Intergenic
1136617008 16:31404382-31404404 CACCCCTGGGAGCAGCCCTGGGG + Intronic
1138142195 16:54578401-54578423 GAAACTTTGGTGCAGCCCAGGGG + Intergenic
1138286019 16:55810806-55810828 GAAAGATGGGGGAAACCCTGAGG + Intronic
1138387133 16:56643465-56643487 GCACCCTGGGGGCGGCCCTTTGG - Intronic
1139587573 16:67914003-67914025 GAAAGCAGGAGGCAGGCCTGGGG + Intronic
1139776634 16:69320611-69320633 GAAACCTGGGGACAGACCCCGGG - Intronic
1140571216 16:76108439-76108461 GAATCATGGGGACTGCCCTGGGG - Intergenic
1141770875 16:86089032-86089054 GAGACCCTGGGGCACCCCTGTGG - Intergenic
1141951434 16:87342517-87342539 GAACTCTGGGTGCAGCCCTCGGG + Intronic
1142009624 16:87707261-87707283 GACACCTGGTGGCAGCCATGTGG + Intronic
1142428128 16:90011504-90011526 TGTGCCTGGGGGCAGCCCTGTGG + Intronic
1142671072 17:1487599-1487621 TAAACCTGGGGGCACCGCAGCGG - Intronic
1142695382 17:1629952-1629974 GACACCGCGCGGCAGCCCTGGGG - Intergenic
1143029393 17:3959510-3959532 GGAGCCTGGGGGCAGCCCAGGGG - Intronic
1143102621 17:4512824-4512846 GAAAGCTGCGGGGAGCCCTCTGG - Intronic
1143498917 17:7327600-7327622 GACACGAGGGGGCAGGCCTGTGG + Exonic
1144329170 17:14208536-14208558 AATACCTGGGGGCAGCCAAGAGG - Exonic
1144658015 17:17050504-17050526 CAGTCCTGGTGGCAGCCCTGGGG + Intronic
1144795407 17:17888057-17888079 GAAGCCTGAGAGCAGCACTGAGG + Intronic
1144944765 17:18964210-18964232 GAGGCATGTGGGCAGCCCTGGGG - Intronic
1145014646 17:19388152-19388174 GAAACCTAGCCTCAGCCCTGAGG - Intergenic
1146492159 17:33291310-33291332 GAGGCCTGGGGACAGCCCCGAGG + Intronic
1147514175 17:41100568-41100590 GAACCCCGGGGACAGGCCTGAGG + Intronic
1147555908 17:41479027-41479049 GAACCTTGGAGGCAGCCCTCTGG - Intronic
1148683293 17:49486780-49486802 GCAACCTGGGGCAAGCCCAGGGG - Intergenic
1148776073 17:50096307-50096329 GCAACCTGGGGGTGGCCCTGGGG + Intronic
1149128575 17:53266719-53266741 ACAACATGGTGGCAGCCCTGTGG - Intergenic
1151222104 17:72620715-72620737 CACACCTGGGGGCTGCCTTGTGG - Intergenic
1151304778 17:73256287-73256309 GAGACATGGGGGCAGCTCTCAGG + Intronic
1151367477 17:73626774-73626796 GAGACCTGGGGACAGGCCTGAGG + Intronic
1151890134 17:76946869-76946891 GAAACCAGGGGACAGCCCCACGG + Intronic
1152031444 17:77845905-77845927 GCCACCTGCGGGCAGCTCTGCGG - Intergenic
1152299340 17:79486061-79486083 CAAGCCTGGGGCGAGCCCTGAGG - Intronic
1152417878 17:80174780-80174802 GGAAGCTGGAGGCAGCTCTGGGG + Intronic
1152493556 17:80654239-80654261 GAAAACTGGGGGCATGCCTGAGG + Intronic
1152635895 17:81430354-81430376 GCCACCTGGGGGGAGCCATGGGG + Intronic
1152737400 17:82004258-82004280 GGATGCCGGGGGCAGCCCTGCGG - Intronic
1152783608 17:82237060-82237082 GGAACCTGGGGGCAGAGATGAGG + Intronic
1152808947 17:82372112-82372134 GAAACCCCGGCCCAGCCCTGCGG - Intergenic
1154191918 18:12237182-12237204 AGACCCTGGGGGAAGCCCTGAGG - Intergenic
1154198472 18:12282846-12282868 GAAAAGTGAGGGCAGCCTTGAGG + Intergenic
1154377358 18:13821282-13821304 GCCTCCTGGGGGCAGGCCTGCGG - Intergenic
1154388482 18:13916745-13916767 AAAACCGGTGGCCAGCCCTGGGG + Intergenic
1155242073 18:23873091-23873113 GGATCTTTGGGGCAGCCCTGGGG + Intronic
1157876608 18:51279704-51279726 GGAACCTGAGGTCAGCCATGTGG - Intergenic
1161007843 19:1945258-1945280 GGAGCCTGGGGCCAGCCCGGGGG - Intronic
1161171811 19:2815927-2815949 GACACCTGGGGACAGCCCACGGG - Intergenic
1161741267 19:6022520-6022542 GTAGCCTGAGGGCAGCCCGGTGG + Intronic
1161952343 19:7474854-7474876 GAAGGCTGGGGGCATCCCAGTGG - Intergenic
1162818414 19:13209296-13209318 GACACAGGTGGGCAGCCCTGTGG - Exonic
1163871761 19:19827509-19827531 GAAAGCTGGTGGAAGCCTTGGGG + Intergenic
1164703576 19:30303389-30303411 GAAACCTGGAGGCAGCGCCAAGG - Intronic
1165698980 19:37922740-37922762 GATACCAGGGTGCAGCCATGAGG + Intronic
1166638724 19:44474827-44474849 GAAAGCTGCGGGCATCCCTTGGG - Intergenic
1166748924 19:45155600-45155622 AAAACTTGGGGGCAGCCAGGAGG + Intronic
1167245536 19:48370971-48370993 GACAGCTGGGGTCAGCCTTGGGG - Intronic
1168588502 19:57614153-57614175 GAAACCTGTGCGCCGCCCGGCGG + Intergenic
925075837 2:1014926-1014948 GAACCCGAGGGGCAGCCTTGAGG + Intronic
925149544 2:1605842-1605864 GTAATATGGGGGCAGCCCTGGGG + Intergenic
925512062 2:4638711-4638733 TCATCCTGAGGGCAGCCCTGTGG + Intergenic
926820386 2:16845482-16845504 AGAACCTGGGGGCAGCAGTGAGG - Intergenic
927885060 2:26713189-26713211 GAAAGGAGGAGGCAGCCCTGGGG + Intronic
928364692 2:30691902-30691924 GAGGCCTTGGGGCATCCCTGGGG + Intergenic
929811023 2:45189537-45189559 GAAGCCGGGGGGCTGCTCTGTGG - Intergenic
934220554 2:90078300-90078322 GATATATGGGGGCAGCCATGTGG + Intergenic
934670235 2:96208073-96208095 GAACCCTGGGGCCTGCCCTGTGG - Intronic
935124207 2:100208642-100208664 GTGTCCTGGGGGCAGACCTGTGG + Intergenic
935337016 2:102025632-102025654 GAAACCTGCAGACAGCCCAGGGG - Intronic
936323462 2:111485755-111485777 GAAACCTGGAGGCAGGATTGTGG + Intergenic
937255892 2:120555280-120555302 GAACACTGAGCGCAGCCCTGTGG - Intergenic
939704164 2:145431357-145431379 GACACATGGAGGCAGACCTGAGG - Intergenic
942748522 2:179263929-179263951 GGAGCCTCGGCGCAGCCCTGGGG + Intronic
945200552 2:207277063-207277085 GGAAGCTGGGCGCAGCTCTGGGG - Intergenic
945771582 2:214049728-214049750 GAAAGTTGGACGCAGCCCTGGGG + Intronic
945974377 2:216259182-216259204 GGGACCTGGCGGGAGCCCTGGGG - Exonic
946382562 2:219358838-219358860 GAAACCTGGGGGAAGGGCAGGGG - Intergenic
947825102 2:233100522-233100544 GACACCTGAGGGCAGGCCAGGGG - Intronic
948831687 2:240601405-240601427 GAAGCCTGCGGAGAGCCCTGAGG + Intronic
948907979 2:240988902-240988924 CAGGCCTGGGGGCAGACCTGGGG + Intronic
1169267152 20:4173825-4173847 GATATCTGGGGGCCACCCTGAGG - Intronic
1170755950 20:19207239-19207261 GGAGCCTGGGGAGAGCCCTGAGG - Intergenic
1172097763 20:32468553-32468575 GCCACATGGGGCCAGCCCTGAGG + Intronic
1172116196 20:32574883-32574905 GAAACCGGGGTGCAGATCTGGGG - Intronic
1172812753 20:37661427-37661449 GACACCAGGGGGCAGACCTAGGG - Intergenic
1174461849 20:50688879-50688901 GGACCCTGGGGGGAGCACTGAGG + Intronic
1174753840 20:53138824-53138846 GAGACTTGGGCACAGCCCTGTGG - Intronic
1175169527 20:57070371-57070393 AAACCCTGGAGCCAGCCCTGAGG + Intergenic
1175888439 20:62305202-62305224 GAAAACTGGTGGCGGGCCTGTGG + Intronic
1176093479 20:63329176-63329198 GCAACCTGGGGGGAGCCCCGTGG + Intronic
1176114161 20:63423875-63423897 GAACCCTGGGGCCAGACTTGTGG + Intronic
1176385991 21:6138754-6138776 GAAGCCGGGGTGCTGCCCTGAGG - Intergenic
1176386156 21:6139387-6139409 GGAGAGTGGGGGCAGCCCTGGGG + Intergenic
1177166709 21:17612426-17612448 GAAACGTGGCAGGAGCCCTGAGG + Intronic
1179418849 21:41219970-41219992 GGAAGCTGGGGGCAGTCTTGGGG - Intronic
1179620747 21:42614089-42614111 GGCACTTGGGGGCTGCCCTGAGG + Intergenic
1179737317 21:43398865-43398887 GGAGAGTGGGGGCAGCCCTGGGG - Intergenic
1179737482 21:43399498-43399520 GAAGCCGGGGTGCTGCCCTGAGG + Intergenic
1179910052 21:44442777-44442799 GAAACTTGGGGGTAGGGCTGAGG - Exonic
1180031430 21:45211109-45211131 AAAGCCTGAGAGCAGCCCTGGGG + Intronic
1180077967 21:45472765-45472787 GAAACCTGTGGGAAACCCAGGGG + Intronic
1182104698 22:27681083-27681105 GAAAATTGGGGGCAGCCCTGGGG + Intergenic
1182393741 22:30020472-30020494 AAGACCTGGGGGCTGCTCTGAGG - Exonic
1182844839 22:33421875-33421897 GAATCCAGGAGGCAGACCTGAGG + Intronic
1183478544 22:38050482-38050504 GAAAGCTGGTGGGAGCCCAGGGG - Intergenic
1184357438 22:43991909-43991931 GATACCTGGAGGCAGGCCTTTGG - Intronic
1184560383 22:45259711-45259733 GATTCCTGGGGGCCGCCCTGGGG - Intergenic
1185039602 22:48497544-48497566 GAATCCTGGGGGCGGGGCTGAGG + Intronic
1185039645 22:48497661-48497683 GAATCCTGGGGGCGGGGCTGAGG + Intronic
1185039688 22:48497778-48497800 GAATCCTGGGGGCGGGGCTGAGG + Intronic
1185264003 22:49888664-49888686 GGAGCCGGTGGGCAGCCCTGAGG + Exonic
952013776 3:28932903-28932925 TAGCCTTGGGGGCAGCCCTGGGG - Intergenic
954144929 3:48629803-48629825 GAAAGCTGCGGGGAGCCCTGTGG + Intronic
954461448 3:50629284-50629306 GAAAGCTAGGTGCAGCCTTGGGG - Intronic
954655384 3:52191223-52191245 GACACCAGGGTGCAGCCCTGAGG + Intergenic
954757458 3:52849200-52849222 GACACCTGGGGCCAGCTGTGAGG + Intronic
956258421 3:67309456-67309478 GAAAGCTGGGGCCACCTCTGAGG - Intergenic
956902361 3:73730062-73730084 GAAAGCTGGGGCCAGCGCTGGGG + Intergenic
960532360 3:118779379-118779401 GAGTCCAGTGGGCAGCCCTGTGG - Intergenic
961652207 3:128422248-128422270 GAAAGCTGGGCGCAGGCCTTGGG + Intergenic
962358385 3:134714501-134714523 GAGCCCTGGGAGCAGGCCTGAGG - Intronic
962734732 3:138315801-138315823 AAAACCTAGGAGCAGACCTGAGG - Intronic
963442335 3:145355946-145355968 GACAGCTGAGGGCAGGCCTGGGG + Intergenic
966715569 3:183010328-183010350 GCACCCTGGGGTCAGCCCTGAGG + Intergenic
967814227 3:193785851-193785873 GAAAGCTGGGGGCAACACAGTGG - Intergenic
968545009 4:1194009-1194031 GAACCCAGGGGGGTGCCCTGTGG + Intronic
968754814 4:2409706-2409728 GACCCCTGCGGGCAGCTCTGTGG + Intronic
969447430 4:7253282-7253304 GAGACCCTGGGGCAGCTCTGGGG + Intronic
969639428 4:8388148-8388170 GAAAGGCGGGGGCAGCCATGGGG - Intronic
969658362 4:8510749-8510771 GAAGCTGGGGGGCTGCCCTGGGG + Intergenic
969667893 4:8572563-8572585 GAGACCAGGGGGCTGGCCTGGGG - Intronic
970598957 4:17625874-17625896 GAAGCCTGTGGGCAGACCTAAGG - Exonic
971707692 4:30068305-30068327 GAAAGCTGTGGGCATGCCTGGGG - Intergenic
978891695 4:113836689-113836711 GAAAACTGGGGCCAGAGCTGAGG + Intergenic
980790286 4:137611455-137611477 GAAACCTGGGGGTAGCCAACTGG - Intergenic
980819675 4:137997441-137997463 GAGGCATGGGGACAGCCCTGGGG - Intergenic
981148439 4:141353185-141353207 AAACGCTGGGAGCAGCCCTGAGG + Intergenic
982349531 4:154399832-154399854 GAAACCTAGGGGGATCCCTCTGG + Intronic
985047573 4:185955859-185955881 GAGACCTGGGGGAAGACCTGGGG - Intronic
985517474 5:354366-354388 GGGACCCGGGGGCTGCCCTGGGG + Intronic
986018178 5:3775993-3776015 GAAACTGGGGGTCAGCGCTGAGG - Intergenic
988617483 5:32789379-32789401 GAAACCTGTGGTCAGTCTTGAGG - Exonic
989001127 5:36762024-36762046 GAACCCAGCGGGCAGCACTGGGG - Intergenic
992752406 5:79873530-79873552 GAAAAATGTGGGCAGCTCTGTGG - Intergenic
997391441 5:133520398-133520420 TATCTCTGGGGGCAGCCCTGGGG - Intronic
997813381 5:136993751-136993773 GGAGCCTGGGGGAATCCCTGGGG + Intronic
998140413 5:139696898-139696920 AAAGCCTGGGGCCAGGCCTGTGG + Intergenic
1000052570 5:157575539-157575561 GAGACCTGGGAGTAGCCTTGCGG - Intronic
1001286514 5:170427680-170427702 GCAGCCTGGGAGCAGTCCTGGGG - Intronic
1001557082 5:172643940-172643962 GAAGCCTGGTGGGAGCCATGGGG - Intronic
1002090456 5:176802572-176802594 GCCACCTTTGGGCAGCCCTGGGG - Intergenic
1002298863 5:178246569-178246591 GTAAGCTGGGGCCAGGCCTGGGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002807764 6:593788-593810 GAAGCATGGGTGCACCCCTGAGG - Intronic
1003460578 6:6324366-6324388 AGAACCTGGGGGTAGCCTTGGGG - Intergenic
1004508832 6:16268030-16268052 GAAAGCTTGGGGCAGGTCTGGGG + Intronic
1006085688 6:31593240-31593262 GAAATCTTGGAGTAGCCCTGGGG - Intergenic
1006392421 6:33766373-33766395 GGGAACTGGGGGCAACCCTGAGG - Intergenic
1007166646 6:39832993-39833015 GTTACCTGGGGGCTGCCCTCGGG - Intronic
1007681930 6:43640041-43640063 GAAACCTCGGGCCACCACTGAGG + Exonic
1007756254 6:44101626-44101648 GACCCCTGGGGGGACCCCTGGGG - Intergenic
1010515731 6:76770899-76770921 ATAGCCTGGTGGCAGCCCTGTGG - Intergenic
1013338145 6:109186332-109186354 GAATCCTGGCTGCAGCCTTGTGG - Intergenic
1013464232 6:110402920-110402942 AAAACCTGGCTGGAGCCCTGTGG - Intronic
1014934029 6:127365515-127365537 AAAACCTTGGGGCACCCCAGGGG + Intergenic
1017131116 6:151108969-151108991 GCAGCCTGAGGCCAGCCCTGGGG + Intergenic
1018945646 6:168345701-168345723 GAAGCTTGGGGGCAGCCGGGGGG + Intergenic
1019058405 6:169239019-169239041 GAGACCTGAGGGCAGCGTTGGGG + Intronic
1019210432 6:170400551-170400573 GAAGCCAGGGAGCAGCCCAGTGG - Intronic
1022332841 7:29396756-29396778 GAGCCCTGGGGGCAGCCTTGCGG - Intronic
1024262096 7:47580979-47581001 GAAGCCTGGGGGCTTCCCAGGGG + Intronic
1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG + Intergenic
1026003753 7:66583857-66583879 AAAAACTGGGGGCAGCCCTGGGG + Intergenic
1026027530 7:66759179-66759201 GAAACCTGGGGGCAGCCCTGGGG - Intronic
1027188358 7:75984679-75984701 GACACCTTGGGCCAGCTCTGCGG - Intronic
1029600706 7:101561904-101561926 GGGAAGTGGGGGCAGCCCTGGGG - Intergenic
1029690079 7:102175489-102175511 GACATGTGGTGGCAGCCCTGGGG - Intronic
1032089325 7:128903439-128903461 GAGACATGGGGTCAGCCCTCAGG - Intronic
1032480656 7:132244139-132244161 GAAACTGGGGGGCAGAGCTGTGG - Intronic
1034434869 7:151058625-151058647 GAAAACTGGGTGGAGCCCTGGGG + Exonic
1034612469 7:152384164-152384186 GAACTCTTGGGGCAGCACTGAGG - Intronic
1034679781 7:152919866-152919888 GAGACCTGAGGGGACCCCTGGGG - Intergenic
1035559822 8:595743-595765 GAAACCTGGAGGAAGCCGAGTGG + Intergenic
1036525570 8:9531223-9531245 CAAACCTGGGGGTAGTCCTGGGG + Intergenic
1038692173 8:29773664-29773686 GATACATGGGGCCAGCCATGTGG + Intergenic
1038700974 8:29849012-29849034 GAACCCTGGGGGGAGCCCTGGGG - Intergenic
1039255241 8:35711465-35711487 GAAAGCTGGGGCCAGCGCGGTGG - Intronic
1039381079 8:37086042-37086064 GACACATGAGGGCAGGCCTGAGG - Intergenic
1039896156 8:41718066-41718088 GGAGCCTGGGGGCAGGCCTGTGG - Intronic
1039909875 8:41817957-41817979 GAAACATGGGTGCAGCCCATTGG - Intronic
1041143516 8:54847055-54847077 GGATCTTGGGGGCAGCCCTGAGG - Intergenic
1045035053 8:98170235-98170257 GAAACCTCCGTGCAGCCCTGGGG + Intergenic
1046229806 8:111338928-111338950 GAAAGATGGAGGCAGCTCTGGGG + Intergenic
1049412758 8:142480828-142480850 GAGACATGGGGGCAGCCTTGGGG - Intronic
1049449914 8:142655054-142655076 GAACCATGGGGGCTGCCCTCAGG + Intergenic
1051760983 9:20464083-20464105 CAAACCTTGGGACAGCCCTCTGG + Intronic
1057392897 9:94654031-94654053 GAACCCAGCTGGCAGCCCTGGGG + Intergenic
1060192849 9:121603973-121603995 GACACCTGGGGGCAGTCCAGAGG + Intronic
1060198961 9:121640734-121640756 GGAACCTGTGGGCAGGCCTACGG + Intronic
1060525166 9:124316341-124316363 GACACCAGGGTGCAGCCCAGTGG + Intronic
1060914981 9:127382937-127382959 GACACCTGACGGCAGCCCTTGGG - Intronic
1061328531 9:129878538-129878560 GGCACCTGGGGGCAGGCATGGGG - Intronic
1190062057 X:47218062-47218084 GAAACCTGGGCGGAGGCGTGCGG + Intronic
1190983195 X:55476199-55476221 GAAACATTGGGGAAGCTCTGCGG + Intergenic
1190985504 X:55496984-55497006 GAAACATTGGGGAAGCTCTGCGG - Intergenic
1192322142 X:70098601-70098623 GTTACCTTGGGGCAGCCCAGTGG + Intergenic
1192859126 X:75047372-75047394 CTAACCTGGGGGCAACCCTTAGG - Intergenic
1192911042 X:75604571-75604593 GAAAAGTAAGGGCAGCCCTGAGG - Intergenic
1199978681 X:152909056-152909078 GGGACCTGGGTGCAGCCCTGGGG + Intergenic
1200058577 X:153474065-153474087 GTAAGCTTGGGGGAGCCCTGCGG + Intronic
1200077477 X:153558336-153558358 GACACCTGGGCTCAGGCCTGAGG + Intronic
1200323836 X:155216862-155216884 GAAAACCGGCGGCAGCCCGGAGG - Intronic
1201862528 Y:18615136-18615158 GATATGTGGGGGCAGCCATGTGG - Intergenic
1201870795 Y:18705244-18705266 GATATGTGGGGGCAGCCATGTGG + Intergenic