ID: 1025990504

View in Genome Browser
Species Human (GRCh38)
Location 7:66493411-66493433
Sequence GACCCACAGAAACACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025990501_1025990504 11 Left 1025990501 7:66493377-66493399 CCTCGGCCGAGCCTGGACATAGT 0: 1
1: 0
2: 1
3: 6
4: 47
Right 1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG No data
1025990500_1025990504 14 Left 1025990500 7:66493374-66493396 CCGCCTCGGCCGAGCCTGGACAT 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG No data
1025990503_1025990504 0 Left 1025990503 7:66493388-66493410 CCTGGACATAGTTTTCTAGTTTT No data
Right 1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG No data
1025990498_1025990504 18 Left 1025990498 7:66493370-66493392 CCTTCCGCCTCGGCCGAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 154
Right 1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG No data
1025990496_1025990504 29 Left 1025990496 7:66493359-66493381 CCTGAACGGATCCTTCCGCCTCG 0: 1
1: 2
2: 0
3: 52
4: 1158
Right 1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG No data
1025990502_1025990504 5 Left 1025990502 7:66493383-66493405 CCGAGCCTGGACATAGTTTTCTA 0: 1
1: 0
2: 4
3: 45
4: 396
Right 1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025990504 Original CRISPR GACCCACAGAAACACTGTGC TGG Intergenic
No off target data available for this crispr