ID: 1025990561

View in Genome Browser
Species Human (GRCh38)
Location 7:66493735-66493757
Sequence CACCGCCTGCTGACACTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025990561_1025990573 29 Left 1025990561 7:66493735-66493757 CCGGTCAGTGTCAGCAGGCGGTG 0: 1
1: 0
2: 2
3: 5
4: 127
Right 1025990573 7:66493787-66493809 GCCGACACCAATAAGCTACAAGG No data
1025990561_1025990566 -7 Left 1025990561 7:66493735-66493757 CCGGTCAGTGTCAGCAGGCGGTG 0: 1
1: 0
2: 2
3: 5
4: 127
Right 1025990566 7:66493751-66493773 GGCGGTGGGTTAGGGTCCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 95
1025990561_1025990567 4 Left 1025990561 7:66493735-66493757 CCGGTCAGTGTCAGCAGGCGGTG 0: 1
1: 0
2: 2
3: 5
4: 127
Right 1025990567 7:66493762-66493784 AGGGTCCGCAGGCCCAGACCAGG 0: 1
1: 0
2: 2
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025990561 Original CRISPR CACCGCCTGCTGACACTGAC CGG (reversed) Intergenic
900180232 1:1308002-1308024 CACCGCCCGCTGTCACTGCCGGG + Exonic
901184038 1:7360714-7360736 CACAGCCTGCTCACTCTGCCAGG - Intronic
901921342 1:12539987-12540009 CACCTCCTGCTCACACGGGCAGG - Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
902535425 1:17116939-17116961 CACAGCCAGCTGAGACTCACTGG - Intronic
903687698 1:25143989-25144011 CACTGCCTGTTAACACTGCCTGG + Intergenic
904265009 1:29313126-29313148 CACCTTCTGCAGACCCTGACTGG + Intronic
906528943 1:46512308-46512330 CAGCGGCTGCTGACAGGGACTGG - Exonic
914917177 1:151825968-151825990 CACCCCCTGCTGAGAAGGACAGG - Intronic
922699519 1:227750650-227750672 CTCCCCCTGCAGACACTGTCAGG - Intronic
1067749804 10:48963434-48963456 CTCCGCCTCCTGACACTCTCTGG + Intronic
1069742012 10:70690841-70690863 CACCGCCTGCTGGCACTTGAGGG + Intronic
1071210540 10:83337022-83337044 CTCTGGCTGCTGTCACTGACAGG + Intergenic
1071478791 10:86047301-86047323 CAACCCCTGCTTACACAGACTGG + Intronic
1074023781 10:109612652-109612674 CACCGCATGTTGTCACTCACAGG - Intergenic
1075044975 10:119139630-119139652 CATCCCCTGCTGGCACTGCCTGG - Intergenic
1075949710 10:126466530-126466552 CACAGCCTGCTTCCACTGGCTGG - Intronic
1076014500 10:127016455-127016477 CACCTCCGGCTGTCCCTGACGGG - Intronic
1076808837 10:132876165-132876187 CACCGGCTGCTGATATTGAGGGG + Intronic
1077389717 11:2294639-2294661 ACCAGCCTGCTGACAATGACAGG + Intergenic
1079339202 11:19598093-19598115 CGCCGCCCCCTGACAGTGACAGG + Intronic
1080517666 11:33039276-33039298 CACCGCCAGCTGAGACTCATCGG + Intergenic
1084769575 11:71334081-71334103 CACTGCCTGGTGACTCTGAAAGG - Intergenic
1085529849 11:77184713-77184735 CCCCGCCTCCCGGCACTGACCGG - Exonic
1088410571 11:109529792-109529814 CACCGCATGTTCTCACTGACAGG + Intergenic
1095832290 12:46601131-46601153 CCCTGCCTGCTGACTCTGAAGGG - Intergenic
1096779140 12:53982203-53982225 CCCCGCCTGCCGCCACTGCCAGG - Intergenic
1101086464 12:101241323-101241345 CAGCCCCTGCTGACACTTAATGG - Intergenic
1101950667 12:109172258-109172280 CACCGCCTGCAAACACAGAAAGG - Exonic
1107467598 13:40665017-40665039 CACCGCCTCCAGAAACTGCCCGG + Intronic
1110462073 13:75756330-75756352 CACTGCCAGCTGAGACTGAAAGG + Intronic
1110491789 13:76118234-76118256 CAGCACCTGCTCACACTGACTGG + Intergenic
1113539082 13:111092846-111092868 CAAAGCCTGCTGACACCCACTGG - Intergenic
1113905769 13:113818526-113818548 CACCGGCTGCTCACACGGTCGGG - Intergenic
1113941168 13:114019241-114019263 CACCTGCTGCTGACACTGCTGGG - Intronic
1117665201 14:58049386-58049408 AACTGACTGCTGACACAGACAGG - Intronic
1118698855 14:68413190-68413212 TACTTCCTGTTGACACTGACTGG - Intronic
1128889686 15:71319476-71319498 CACCGCATGTTCTCACTGACAGG - Intronic
1129250070 15:74303782-74303804 CACCGCCTGCTGACAGGGGCTGG + Intronic
1134097875 16:11431068-11431090 CCCCGCCTCCTGACACTCACAGG - Exonic
1135477621 16:22791037-22791059 CACCGCATGCTGTCACTCATAGG + Intergenic
1137488804 16:48913645-48913667 CACCTCATCCTGACAGTGACAGG + Intergenic
1138351797 16:56349924-56349946 CACAGCCTGCTGATATGGACTGG + Intronic
1140619404 16:76709934-76709956 CACTGCCTGTGGACAATGACTGG + Intergenic
1141423581 16:83931966-83931988 CACAGCCAGCTGAGAATGACAGG - Intronic
1142432402 16:90036942-90036964 CACTGCATGCTGGCAGTGACAGG + Intronic
1143005967 17:3834328-3834350 CACAGACTGTTGACAATGACGGG + Intronic
1144763173 17:17718760-17718782 GACCCCCTGCTGACTCAGACAGG + Intronic
1145782432 17:27571872-27571894 CTGGGCCTGCTGACACTGAGAGG - Intronic
1146352942 17:32111254-32111276 CACCGCATCCTCACGCTGACGGG - Intergenic
1148126959 17:45242036-45242058 CACCACCTCCGGGCACTGACGGG + Exonic
1148346705 17:46908231-46908253 CAACGTGTCCTGACACTGACAGG - Intergenic
1149645136 17:58235401-58235423 CACAGCATGCTGAGACTGAAGGG - Intronic
1151704330 17:75758654-75758676 CACCGCCTGCTGGTCCTCACAGG - Intronic
1151975489 17:77481662-77481684 TACCGCCTGCTGCCACTCAAAGG - Intronic
1152226389 17:79094752-79094774 CACAGTGTGCTGACCCTGACGGG + Intronic
1152557102 17:81058895-81058917 CACCGCCTGCCGACTCAGCCAGG - Intronic
1152686463 17:81696125-81696147 CACCTCCTGTTGACACTCTCTGG - Intronic
1152848222 17:82615612-82615634 CGCCGCATCCTCACACTGACGGG - Exonic
1153706386 18:7749632-7749654 CACCACCTCCTCACACTGATCGG - Intronic
1157589266 18:48826493-48826515 CACCGCCTCCTCACCCTGCCTGG + Intronic
1159480316 18:68981818-68981840 CACCGCCTGTTGTCACTCATAGG - Intronic
1161482186 19:4516794-4516816 CACCTCCTGCTGTCCCTGGCGGG - Intronic
1163645344 19:18486091-18486113 CACCCCCTGCTGACCTTGGCAGG + Intronic
1165964042 19:39559616-39559638 CACCCCCTGCTCACACTGCTGGG + Intergenic
1166903704 19:46087684-46087706 CACTGCCTGCTGCCACTTGCAGG - Intergenic
926091759 2:10055796-10055818 CACCTGCTGCTGACATTGATTGG - Intergenic
926148662 2:10412352-10412374 CACAGCCTGCAGTCAATGACTGG - Intronic
926304571 2:11628726-11628748 TACCCACTCCTGACACTGACAGG - Intronic
928816890 2:35307681-35307703 GACCCCCTGCTGCCACAGACTGG + Intergenic
931856377 2:66306008-66306030 GACCGCCAGCTGGCAATGACTGG + Intergenic
934537654 2:95149112-95149134 CACCCCCTCTTGACATTGACAGG + Exonic
934649590 2:96083376-96083398 CCCCTCCTCCTGACACTGCCAGG - Intergenic
936529776 2:113268198-113268220 CTTCGCCTGCTGACAGGGACTGG - Intronic
937468523 2:122155660-122155682 CACCGCCTGTGGACACTGCTGGG - Intergenic
938068532 2:128294469-128294491 CAGCGCCTCTTGACTCTGACAGG - Intronic
941143691 2:161816707-161816729 CACCGCATGTTGTCACTCACAGG - Intronic
946861965 2:224008924-224008946 GACCAGCTGCTGACACTGAACGG + Intronic
948152010 2:235751910-235751932 CACCTCCTGCTGCCTCTGTCGGG + Intronic
948637651 2:239349655-239349677 CACCACCTGCACACACTGGCTGG - Intronic
1170011436 20:11728203-11728225 TCCAGCCTGCTGCCACTGACTGG - Intergenic
1170354328 20:15475683-15475705 CAGCACATGCTGACACTAACGGG - Intronic
1170517778 20:17149489-17149511 CACTGTCTGCTGTCACTCACTGG + Intergenic
1173793140 20:45841032-45841054 CGCCCCCTGCTGACCCTGGCTGG + Exonic
1175245346 20:57578907-57578929 CACTGCCTGGTGACACCCACTGG + Intergenic
1175630534 20:60531892-60531914 CACCGCATGCTCTCACTCACAGG + Intergenic
1175954826 20:62603875-62603897 CCCCGCCTGCAGTAACTGACAGG + Intergenic
1180199176 21:46214607-46214629 CAGGGCCTGCTGACTCTGTCAGG + Intronic
1180987105 22:19911581-19911603 CACAGCCTGCAGACAAGGACTGG - Intronic
1181020012 22:20094852-20094874 CACCCCCAGCTCACACTAACAGG - Intronic
1181280246 22:21714531-21714553 CACTGCATGCAGCCACTGACGGG + Intronic
1181952258 22:26563090-26563112 CATAGCCTCCTGAAACTGACTGG + Intronic
1183704074 22:39466256-39466278 CACCGCTTGCGGGCAGTGACCGG + Intronic
1185071448 22:48658978-48659000 CACCTGCTCCTGACAATGACGGG - Intronic
954759002 3:52860678-52860700 GACCACATGCTGGCACTGACCGG + Intronic
963987559 3:151614584-151614606 CACCGCATGCTGTCACTCATAGG + Intergenic
966508297 3:180731709-180731731 CACCACCTGCACACACTGCCTGG + Intronic
968235242 3:197027448-197027470 AACCGCCTGCGGCCACTGAGGGG + Intronic
968430292 4:554454-554476 CACCGCCTACTGAGACAGATGGG - Intergenic
968631503 4:1654454-1654476 CACCTCCTGCAGAAACTGTCTGG - Intronic
972112229 4:35578500-35578522 CACCGCATGTTCACACTCACAGG + Intergenic
973799315 4:54460683-54460705 CTCAGCCAGCTGACACTTACGGG + Intergenic
982964272 4:161883231-161883253 CAGCTCCTGCTGAGACTGTCAGG + Intronic
985704647 5:1393282-1393304 CACTGCCCTCTGCCACTGACAGG - Exonic
987792491 5:22586251-22586273 CACCGCATGCTCTCACTCACAGG + Intronic
997672143 5:135683904-135683926 CATGGCCTGCTGACACTGCAGGG - Intergenic
998399393 5:141840571-141840593 AACCTCCTGCTGACACTGCCAGG + Intergenic
1002605747 5:180381779-180381801 CCCTCCCTGCTGACACTGTCTGG + Intergenic
1009324192 6:62329661-62329683 CACCGCCTGCAAACACGCACAGG + Intergenic
1010386324 6:75284687-75284709 GCCCGCCGGCTGACCCTGACAGG + Exonic
1020386085 7:7603975-7603997 CACCGCATGTTCTCACTGACAGG + Intronic
1021156910 7:17221111-17221133 CACCGCCTGTTCTCACTCACAGG + Intergenic
1021786669 7:24159096-24159118 GAGCCCCTGCTGAGACTGACTGG - Intergenic
1024645040 7:51363751-51363773 AACCGCCTGTTGACCCTCACAGG - Intergenic
1024973578 7:55092780-55092802 CACCGCCCGCTGGCCCTGCCAGG - Intronic
1025234549 7:57225682-57225704 CACCTGCTGTTGAAACTGACTGG + Intergenic
1025990561 7:66493735-66493757 CACCGCCTGCTGACACTGACCGG - Intergenic
1026015414 7:66667542-66667564 CACCGAGCCCTGACACTGACAGG + Intronic
1026891825 7:73986694-73986716 CACCGTGCCCTGACACTGACAGG + Intergenic
1027213218 7:76166724-76166746 CGCCGCCTACTGACACTGACCGG - Intergenic
1030284384 7:107810795-107810817 CACCCCCAGCAGACACTGAGTGG + Intergenic
1031751879 7:125585277-125585299 CACCGCCTGTTCTCACTCACAGG + Intergenic
1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG + Intronic
1038034899 8:23679247-23679269 CACGTGCTGCTGACACCGACCGG - Exonic
1040961922 8:53043396-53043418 CACCGCATGTTGTCACTGATAGG - Intergenic
1044475297 8:92618817-92618839 CACAGCCTGCTGAGCCTCACAGG + Intergenic
1047625560 8:126652597-126652619 CATCACCTGGTGACTCTGACAGG + Intergenic
1049786947 8:144455603-144455625 CACCTCCTGGTGAGACTGCCGGG + Intronic
1052110308 9:24574367-24574389 CACCGCATGTTCTCACTGACAGG - Intergenic
1053314512 9:37040410-37040432 CACCGCCTGCAGACACTGGCAGG - Intergenic
1058106579 9:100978817-100978839 TACAGCCTGGTGACATTGACTGG - Intergenic
1061909703 9:133716152-133716174 CACAGCCTGAGGACACAGACGGG - Intronic
1189803658 X:44714702-44714724 CACCTCCAGCTGACATGGACAGG - Intergenic
1190708959 X:53051510-53051532 CACGGCCTGCTTACACACACAGG - Intronic
1191735127 X:64380822-64380844 CACCGCATGTTGTCACTGATAGG - Intronic