ID: 1025996067

View in Genome Browser
Species Human (GRCh38)
Location 7:66528271-66528293
Sequence CAGCCCCTTGCAGGCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 1, 2: 1, 3: 70, 4: 527}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996067_1025996078 24 Left 1025996067 7:66528271-66528293 CCAGCCCTGCCTGCAAGGGGCTG 0: 1
1: 1
2: 1
3: 70
4: 527
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996067_1025996076 17 Left 1025996067 7:66528271-66528293 CCAGCCCTGCCTGCAAGGGGCTG 0: 1
1: 1
2: 1
3: 70
4: 527
Right 1025996076 7:66528311-66528333 CCCTGAGGGCTGAACACCATTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1025996067_1025996071 2 Left 1025996067 7:66528271-66528293 CCAGCCCTGCCTGCAAGGGGCTG 0: 1
1: 1
2: 1
3: 70
4: 527
Right 1025996071 7:66528296-66528318 ACAACCCACGCTCGACCCTGAGG No data
1025996067_1025996072 3 Left 1025996067 7:66528271-66528293 CCAGCCCTGCCTGCAAGGGGCTG 0: 1
1: 1
2: 1
3: 70
4: 527
Right 1025996072 7:66528297-66528319 CAACCCACGCTCGACCCTGAGGG 0: 1
1: 1
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996067 Original CRISPR CAGCCCCTTGCAGGCAGGGC TGG (reversed) Intergenic