ID: 1025996068

View in Genome Browser
Species Human (GRCh38)
Location 7:66528275-66528297
Sequence GTCTCAGCCCCTTGCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996068_1025996072 -1 Left 1025996068 7:66528275-66528297 CCCTGCCTGCAAGGGGCTGAGAC 0: 1
1: 1
2: 2
3: 23
4: 306
Right 1025996072 7:66528297-66528319 CAACCCACGCTCGACCCTGAGGG 0: 1
1: 1
2: 0
3: 2
4: 46
1025996068_1025996076 13 Left 1025996068 7:66528275-66528297 CCCTGCCTGCAAGGGGCTGAGAC 0: 1
1: 1
2: 2
3: 23
4: 306
Right 1025996076 7:66528311-66528333 CCCTGAGGGCTGAACACCATTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1025996068_1025996071 -2 Left 1025996068 7:66528275-66528297 CCCTGCCTGCAAGGGGCTGAGAC 0: 1
1: 1
2: 2
3: 23
4: 306
Right 1025996071 7:66528296-66528318 ACAACCCACGCTCGACCCTGAGG No data
1025996068_1025996078 20 Left 1025996068 7:66528275-66528297 CCCTGCCTGCAAGGGGCTGAGAC 0: 1
1: 1
2: 2
3: 23
4: 306
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996068 Original CRISPR GTCTCAGCCCCTTGCAGGCA GGG (reversed) Intergenic
900125440 1:1067064-1067086 TCCTCAGCCCCTTGCTGGCCTGG + Intergenic
900494194 1:2969096-2969118 CTCTCTGCCCCTCCCAGGCATGG + Intergenic
900903948 1:5537445-5537467 GTCTCAGCCTCTTACAGAAAGGG - Intergenic
900929100 1:5725155-5725177 GGCTCAGCCCCCGGCAGGCAAGG + Intergenic
901238201 1:7678769-7678791 GCCTGAGCCCCTTGCAGGGGTGG + Intronic
901317457 1:8318429-8318451 GTCTCCTCCCCTTGCCAGCAAGG - Intronic
901558054 1:10047306-10047328 GTCTGGCCCCCTAGCAGGCATGG - Intronic
902299635 1:15492870-15492892 GCCTCAGCCTCTTTCAGGCCTGG + Exonic
903643034 1:24872645-24872667 ATGTCAGCCCCTTGAAGGCGAGG + Intergenic
904329655 1:29749973-29749995 GTCTCACAGCCTTGCAGGGATGG - Intergenic
904350099 1:29899449-29899471 GTCTCAGAGCCTAGCAGGCCAGG + Intergenic
906225600 1:44118998-44119020 GTGCCAGCCCCTGGCAGGCCGGG + Intronic
906298338 1:44662773-44662795 GTCACATCCCCTGGCAGCCACGG + Intronic
907933695 1:59022967-59022989 GTATCTGTCCTTTGCAGGCAGGG + Intergenic
908826114 1:68134345-68134367 GTCACAGCACCATGCAGGAAAGG + Intronic
909928514 1:81467542-81467564 GTCTCAAACCCTTGCATGCAGGG + Intronic
910035914 1:82788622-82788644 GTCTAAGCTCCTTGAAGGCAGGG + Intergenic
912643972 1:111373175-111373197 GGCTCAGCACCTTGAAGGGAAGG + Intergenic
914918346 1:151831687-151831709 GTCTCTTCCACCTGCAGGCAGGG + Intronic
917195074 1:172456261-172456283 GTCTCAGCCCCATCCAGGGTGGG - Intronic
920365470 1:205446066-205446088 GTTTCAGCCGTCTGCAGGCAGGG + Intronic
923255849 1:232220769-232220791 GTGTAAGCTCCTTGAAGGCAGGG - Intergenic
1062826989 10:577647-577669 ATCTGAGCACCTTGAAGGCAGGG - Intronic
1063090491 10:2862105-2862127 TTTTAAGTCCCTTGCAGGCAAGG - Intergenic
1063117745 10:3084232-3084254 GTCCCAGCCCCGCGCAGGGAAGG + Intronic
1063131953 10:3185810-3185832 CTCTCAACCCCTTGCAGGATGGG - Intergenic
1065008761 10:21403117-21403139 CTCTCAGTCCCATGAAGGCAAGG + Intergenic
1065129804 10:22609063-22609085 CTCTGAGCCCCTTGAGGGCAGGG + Intronic
1065893093 10:30137764-30137786 GACTTGGCCCCTTCCAGGCAGGG - Intergenic
1067729010 10:48795675-48795697 GTCTCAGCTCCTTCCATCCATGG - Intronic
1068502535 10:57858229-57858251 GCATCAGCCCCTTTCAGCCATGG + Intergenic
1069664009 10:70143013-70143035 TTCTCAGCCTCTTCCAGCCAGGG - Intronic
1069739394 10:70677811-70677833 GACACAGCCCCTTGCTGTCACGG - Intronic
1069789924 10:71013020-71013042 GCCTCAGCGCCTGGCAGGGAGGG + Intergenic
1073188363 10:101631278-101631300 GTCTTTACCCCTTGAAGGCAAGG - Intronic
1074403789 10:113163778-113163800 ATCTCAGCCTCTGGGAGGCAGGG + Intronic
1074573966 10:114651111-114651133 GCCTCAGCTACTTGAAGGCAGGG + Intronic
1075782763 10:125027436-125027458 GTCGCAGCCCCCTGCTGCCACGG - Exonic
1076014516 10:127016547-127016569 GTCTCAGTTCCTTCCACGCAGGG + Intronic
1078738972 11:14048871-14048893 ATCTCAGACCCTTCCAGGAAGGG - Intronic
1080720907 11:34847825-34847847 CTCTCCTCCCCTTGCAGGCCTGG - Intergenic
1081854189 11:46293672-46293694 GTCCCAGCCCCATGCAAGCCCGG + Intronic
1083261803 11:61527161-61527183 GTCTCAGCGGCCTCCAGGCATGG + Intronic
1083772704 11:64877502-64877524 GGGGCAGCCCCTTGGAGGCAGGG - Intronic
1085475050 11:76784047-76784069 GTCGCAGCCCCTTGCTGTCCTGG - Intronic
1086922625 11:92604745-92604767 CTCTGAGCCCCTTCCTGGCATGG + Intronic
1087268968 11:96091921-96091943 GAATCAGCCCATTGCAGGAATGG - Exonic
1087739611 11:101872324-101872346 GACTCTGCCACTTGCAGGCTAGG + Intronic
1087845312 11:102965138-102965160 CTCTCAACCCCTTGCAGGAAGGG - Intergenic
1088843719 11:113647753-113647775 GTCTCACCCTCTTTCAGCCACGG + Intergenic
1089594964 11:119572814-119572836 GTCTCAGAACTTTGGAGGCAGGG + Intergenic
1090351508 11:126111269-126111291 GGCTCAGTCCCTTGCGTGCAGGG - Intergenic
1090867862 11:130718127-130718149 ATTTCAGCTCATTGCAGGCAGGG + Intergenic
1096521233 12:52185896-52185918 GCCCCAGCCCCAGGCAGGCATGG - Intronic
1097226327 12:57478701-57478723 GTCTCAGGCCCTCCCAAGCAGGG - Exonic
1097503661 12:60438027-60438049 CTCTCAACCCCTTGCAGGAGGGG + Intergenic
1099253598 12:80288937-80288959 ATCACAGCTCCTTTCAGGCAAGG - Intronic
1099462684 12:82943345-82943367 GTCTCAGCACTTTCCAGGAAAGG - Intronic
1100344335 12:93712347-93712369 GTGTCAGCCTTTTGCAAGCAAGG + Intronic
1100757882 12:97772664-97772686 CTCTCAACCCCTTGCAGGAGGGG + Intergenic
1102099638 12:110268648-110268670 GTCCCAGCACATTGCATGCATGG + Intergenic
1102242021 12:111330338-111330360 CTGTGAGCCCCTTGAAGGCAAGG - Intronic
1102511992 12:113422148-113422170 GTCTCTGCCCCTTGCTGTCTGGG + Intronic
1102972314 12:117178883-117178905 GTATAAGCCCCATGAAGGCAGGG + Intronic
1103521568 12:121539456-121539478 GCCTCAGCTCCTTGAAGGCAGGG + Intronic
1104533288 12:129593472-129593494 GTCTCAGACACTTGAAGGCTGGG + Intronic
1105283267 13:18982390-18982412 GTCTCATCCCCTTTCTGGCCTGG + Intergenic
1105546259 13:21352980-21353002 GTATGAACCCCCTGCAGGCAGGG - Intergenic
1108668098 13:52652659-52652681 GTCCCCGCCCCTCGCAGCCATGG - Intergenic
1109222492 13:59654375-59654397 GTCTAAGATCCATGCAGGCAAGG - Intergenic
1110071272 13:71182237-71182259 CTCTCAACCCCTTGCAGGAGGGG + Intergenic
1110183034 13:72639741-72639763 CTATCAGCCCCTTGAAAGCAAGG + Intergenic
1110410882 13:75202923-75202945 GTCTATGTCCCTTGAAGGCAGGG - Intergenic
1113389000 13:109877913-109877935 GTCCCATTCCCTGGCAGGCAGGG + Intergenic
1113673111 13:112188368-112188390 GTGGCAGCCCCTTGCAGGGCTGG - Intergenic
1114083698 14:19221393-19221415 TTCCCAGACCCTTCCAGGCAGGG - Intergenic
1114688206 14:24555093-24555115 ATCTGAGCCCCTTGGAGCCAAGG - Intergenic
1116159851 14:41254063-41254085 TTCTCTGCCCTTGGCAGGCACGG - Intergenic
1116165464 14:41329405-41329427 ATCACAGCCCCTTGCCAGCAAGG - Intergenic
1118321913 14:64758282-64758304 ATCTCAGCCACTGGCAGGCAAGG + Intronic
1118989182 14:70782478-70782500 ATCCCATCACCTTGCAGGCAAGG + Intronic
1119416478 14:74473657-74473679 CTCTAAGCTCCTTGAAGGCAAGG + Intergenic
1119570141 14:75662632-75662654 GTTTAAGACCCTTGCAGGCCGGG - Intronic
1119703014 14:76768083-76768105 GTGGCAGCCCCTGCCAGGCAGGG - Intronic
1120187734 14:81411772-81411794 ATGTAAGCCCCTTGAAGGCAGGG - Intronic
1121639738 14:95477261-95477283 GCCTTAGCCCCTTCCAGGCCTGG + Intergenic
1122107516 14:99469789-99469811 GACTCATCCCCATGCATGCAAGG + Intronic
1122920960 14:104879931-104879953 GGCCCTGCCCCTTGCAGGCTGGG - Intronic
1124413390 15:29455141-29455163 GTCTCATCCCCCAGCAGGCTGGG - Intronic
1124694862 15:31855998-31856020 GTGGCAGCCCCTCCCAGGCATGG - Intronic
1127666615 15:61153959-61153981 GTGTGAGCCCACTGCAGGCAAGG - Intronic
1128325219 15:66719714-66719736 GTCCCAGGCCCAGGCAGGCAAGG + Intronic
1129182140 15:73884307-73884329 TTCTCAGCCACTTCCAGGGAGGG + Intronic
1129706966 15:77799895-77799917 GTCACAGCCGCTGGGAGGCATGG - Intronic
1132402842 15:101523947-101523969 GTCTCAGCACCCTGCAGGGCAGG - Intronic
1133889936 16:9869180-9869202 ATCTCAGCACTTTGAAGGCAAGG + Intronic
1134679429 16:16113884-16113906 GTCTAGGTCCCTTGCATGCACGG + Intronic
1134820906 16:17246733-17246755 GTCCTAGCCCCGTGCAGGCAGGG + Intronic
1135572252 16:23557933-23557955 CCCTAACCCCCTTGCAGGCATGG + Exonic
1136103065 16:28009609-28009631 GTCTCTGGCCCTACCAGGCAAGG + Intronic
1136731472 16:32417628-32417650 GTCTTAGCAACTAGCAGGCAAGG - Intergenic
1137237206 16:46625892-46625914 GCCCCAGCCCCTTCCAGGCGGGG - Intergenic
1139449326 16:67017256-67017278 GCCTCAGCCCCCTGTAGCCATGG + Intergenic
1141701091 16:85642479-85642501 GTCTCAGCCCCTTGGAAGGAGGG - Intronic
1141809191 16:86363154-86363176 ATTTCAGACCCTTCCAGGCAGGG - Intergenic
1202994920 16_KI270728v1_random:99642-99664 GTCTTAGCAACTAGCAGGCAAGG + Intergenic
1203021607 16_KI270728v1_random:411984-412006 GTCTTAGCAACTAGCAGGCAAGG + Intergenic
1142480445 17:215474-215496 CTCTCTGTTCCTTGCAGGCAGGG + Intronic
1143938880 17:10517064-10517086 TTATAAGCACCTTGCAGGCAGGG + Intronic
1144710014 17:17395397-17395419 GACTCAGCTCCTCCCAGGCAGGG + Intergenic
1144786367 17:17834555-17834577 GTCCCAGCCCCTTGAAGACTGGG - Intronic
1146949883 17:36898611-36898633 GACTCAGGCCATGGCAGGCATGG + Intergenic
1147252406 17:39160853-39160875 ATCTCTGCCCCATCCAGGCATGG - Intronic
1147457629 17:40548024-40548046 GTCACAGCCCCTGGCAGGTGGGG + Intergenic
1148357975 17:46988872-46988894 GACTGAGCTCCTTGAAGGCAGGG - Intronic
1148744962 17:49912961-49912983 GTCTCTGCCTCTTTCAGGCCTGG - Intergenic
1150122454 17:62615577-62615599 GTCTCAGGGCATTGCAGGCATGG + Intergenic
1150223233 17:63508865-63508887 GACTCAGGGCCTTGCAGGCATGG + Intronic
1150770517 17:68036914-68036936 GTCTCAGCCCTTTAGAGGGAAGG + Intronic
1150801763 17:68288723-68288745 TTCTAAGCCCTTTGAAGGCAAGG + Intronic
1151829197 17:76539841-76539863 GTGGCAGCTCCTTGCAAGCAAGG + Intronic
1152030933 17:77842571-77842593 GACTCACTCACTTGCAGGCAGGG - Intergenic
1152165067 17:78698484-78698506 GTCTCAGCATCTAGCAGGCTTGG - Intronic
1152779521 17:82220057-82220079 GGCTCAGCCCTTTGGAGGCTGGG - Intergenic
1153741153 18:8129989-8130011 CTCTCAGCCCATTGGAGACATGG - Intronic
1153985090 18:10344248-10344270 GCTTCTGCCCCTTGCAAGCAGGG + Intergenic
1153995192 18:10434384-10434406 CTCTCAGCCCCTGGCAAGCCAGG + Intergenic
1154412802 18:14150457-14150479 GGCTCAGCACCCTGCAGGGAGGG + Intergenic
1155787239 18:29915733-29915755 CTCTCAACCCCTTGCAGGAGAGG - Intergenic
1157003107 18:43550518-43550540 GTCTTGGCCCCTTTCAGCCATGG + Intergenic
1157025301 18:43835784-43835806 GTCTTAGCAACTGGCAGGCAAGG + Intergenic
1157195808 18:45619362-45619384 ATGTGAGCCCTTTGCAGGCAAGG + Intronic
1157731703 18:50009851-50009873 GTCTCAGGCACCTGGAGGCAGGG + Intronic
1158190653 18:54824682-54824704 TTCTTAGCCCCTTGCAGGTGGGG - Intronic
1159014943 18:63093690-63093712 TTCTCTGCCACTTGCAGGTAGGG - Intergenic
1159074020 18:63659838-63659860 CTCTCAGCTCCTTAAAGGCAAGG + Intronic
1160348700 18:78155420-78155442 TCCTCAGACCCTTGCAGGTAGGG + Intergenic
1160504882 18:79421442-79421464 GGCACCGCCCCTTGCAGCCAGGG - Intronic
1160831406 19:1106347-1106369 GCCTCAGCCCCTTGCAGGGGTGG + Intronic
1161133956 19:2608696-2608718 GTGTCTGCCCCATGCAGGGAAGG - Intronic
1161333267 19:3698265-3698287 GGCTCAGCCCCTAGCACACACGG + Intronic
1163508485 19:17721746-17721768 GTGTGGGCCCCTTGCAGGAAGGG + Intronic
1163618282 19:18342324-18342346 GCCACATCCCCTTTCAGGCAAGG - Intronic
1163822864 19:19506099-19506121 GCCACAGCCCCTGGCAGGGACGG + Exonic
1164460800 19:28445886-28445908 GTCTTTCCCCCTTCCAGGCAGGG - Intergenic
1164686270 19:30168628-30168650 CTCTCAGCTCCATGAAGGCAGGG + Intergenic
1165093505 19:33398301-33398323 GGCTCAGCCCCTTGCAGCCTGGG + Intronic
1165306210 19:35004568-35004590 GCGTCAGGTCCTTGCAGGCAGGG + Intronic
1165423684 19:35734136-35734158 CTCTCAGCTCCTGGCAGGCTAGG - Intronic
1166104145 19:40589397-40589419 GTGCCAGCCCAGTGCAGGCAGGG + Intronic
1167158842 19:47755053-47755075 TTCCCAGCCTCTTCCAGGCAGGG + Intronic
1167192999 19:48004772-48004794 CTCTCAGCCCCACGAAGGCAGGG + Intronic
1167403832 19:49290806-49290828 GCCTCACCACCTTGGAGGCAGGG + Intronic
1167759107 19:51433279-51433301 ATCACAGCCCCTGGCAAGCATGG + Intergenic
1168116403 19:54223303-54223325 GAGTCAGCCCCTTTCAGGCGAGG + Intronic
1168130207 19:54312908-54312930 GAGTCAGCCCCTTTCAGGCGAGG + Intronic
1168185199 19:54696078-54696100 GAGTCAGCCCCTTTCAGGCGAGG - Intronic
1168571585 19:57475441-57475463 GTCTCAGAGCCTTGCAGGCATGG - Intronic
925212982 2:2066671-2066693 GTAGCTGCCCCTTGCAAGCATGG + Intronic
927856990 2:26534026-26534048 GACTGAGCCCCTTGAGGGCAGGG + Intronic
927974285 2:27326481-27326503 ATCACAGCCCCCTGCGGGCAGGG - Exonic
928411050 2:31054094-31054116 GTGTGATCTCCTTGCAGGCAGGG - Intronic
928732367 2:34246127-34246149 GTCTCAGCTGCTTGCAGTCTAGG + Intergenic
930771951 2:55137996-55138018 GCCTCCTCCCCTTCCAGGCATGG + Intergenic
930818483 2:55622029-55622051 GCCTCAGCCCCTGGCAGGAGGGG - Intergenic
932608061 2:73177424-73177446 GGCACAGCCCCTTCCCGGCACGG + Intergenic
932759808 2:74431735-74431757 GTCCCAGCCCCTCACAGGTATGG - Intronic
936909872 2:117579527-117579549 GTCTTAGCAACTGGCAGGCAAGG + Intergenic
937130462 2:119508154-119508176 GTCTCATGCCCTTGAAGGAAAGG + Intronic
937496790 2:122428978-122429000 GCATCTGCTCCTTGCAGGCAGGG - Intergenic
939575524 2:143890579-143890601 GTATCAGCTCATTGAAGGCAGGG - Intergenic
940855891 2:158728507-158728529 GTCTCCTCCCCATGCCGGCAGGG - Intergenic
940857418 2:158740280-158740302 GTCTCAGGCCCTTCCAGTCCTGG - Intergenic
941978636 2:171432052-171432074 GGCTCAGCCCCTGGCAGGAGAGG - Intronic
942460871 2:176167894-176167916 CTGTAAGCTCCTTGCAGGCAGGG - Intronic
943003683 2:182362471-182362493 CTCTCAGCCCTGTGCAGGCCAGG - Intronic
943640578 2:190353295-190353317 GTCTCAGCCTCTAGGAGCCAGGG + Intronic
945868553 2:215202920-215202942 CTCTCAACCCCTTGCAGGAGGGG + Intergenic
946696867 2:222368580-222368602 GTCTCAGCAACTGGCAGACAAGG - Intergenic
947490416 2:230590046-230590068 GCCTCCTCCCCTTGCAGACATGG + Intergenic
948019716 2:234720519-234720541 GTCTCAGCCCCTTCCCCGCAGGG + Intergenic
948421451 2:237863033-237863055 GTGTCTGTCCCTTGCAGGGACGG + Intronic
948668098 2:239548809-239548831 GGCCCAGCCGGTTGCAGGCAAGG + Intergenic
948683786 2:239658213-239658235 CTCTGAGACCCTTGCGGGCAGGG - Intergenic
1168853959 20:995780-995802 TGCTCAGCCCCTTTCAGTCATGG - Intronic
1169039722 20:2483010-2483032 GTGTCAGCCCTTATCAGGCATGG - Exonic
1170296633 20:14833268-14833290 ATCTTAGCCCCTTGCAGGGCAGG - Intronic
1170864739 20:20143206-20143228 GTCTCAGCCTCCTGAAGTCAGGG - Intronic
1173192149 20:40884896-40884918 GGCTCAGGCCTTGGCAGGCATGG - Intergenic
1173257978 20:41408562-41408584 GTCTCAGTCCCTTGCTGGCATGG + Intronic
1173381922 20:42552928-42552950 GTCTCAGGTACTGGCAGGCAAGG + Intronic
1174178542 20:48659863-48659885 GCCAGAGCCCCCTGCAGGCATGG - Intronic
1175242725 20:57561658-57561680 GTCCCAGCACCCTGCAGGCAGGG + Intronic
1176376292 21:6088372-6088394 GTCTCTGCCACGTGCAGGGATGG - Intergenic
1176860205 21:14007798-14007820 GGCTCAGCACCCTGCAGGGAGGG - Intergenic
1178096535 21:29221614-29221636 ATCTCAGCCCCATGCATGCTTGG - Intronic
1179747183 21:43449872-43449894 GTCTCTGCCACGTGCAGGGATGG + Intergenic
1180163109 21:46006809-46006831 CTCCCAGCCCCTGCCAGGCATGG - Intergenic
1180294277 22:10871874-10871896 TTCCCAGACCCTTCCAGGCAGGG + Intergenic
1180497083 22:15901288-15901310 TTCCCAGACCCTTCCAGGCAGGG + Intergenic
1181030582 22:20147367-20147389 GTCTCAGGCCCTGGCAGGCTGGG - Exonic
1181512727 22:23396014-23396036 GTCTCAGGCGCTGGCAGGCTGGG + Intergenic
1181940219 22:26470106-26470128 GTCACAGCCCAGGGCAGGCAGGG - Intronic
1182125109 22:27810542-27810564 GTCTCAGGACCATGCAGCCAGGG - Intergenic
1182888952 22:33800136-33800158 TAGTAAGCCCCTTGCAGGCAAGG + Intronic
1183347589 22:37316495-37316517 ATGTGAGCCCCATGCAGGCAGGG - Intergenic
1184109606 22:42387251-42387273 GGGTCAGCCCTTTACAGGCAGGG - Intronic
1184117079 22:42428400-42428422 GTCTCAGCCGGGAGCAGGCAGGG + Intronic
1184117908 22:42432619-42432641 GTCTCGGCCCCTTTCCAGCAGGG + Intergenic
1184600193 22:45538923-45538945 GTCTCTGCCCCTATCATGCATGG + Intronic
1184671492 22:46014176-46014198 GTCTCAGCCCCCTCCAGACTGGG + Intergenic
1185375606 22:50481527-50481549 GGCTCCGCCCCTTGCTGGAAAGG + Intergenic
1185419868 22:50729262-50729284 GTCCCTGCCCCATACAGGCATGG - Intergenic
950132626 3:10557751-10557773 ATCTCAGTACCTGGCAGGCATGG + Intronic
950431099 3:12951736-12951758 GTCGCCTCCCCTGGCAGGCAGGG + Intronic
950656831 3:14441732-14441754 GCCTCAGGGCCTTGCAGGCAGGG - Intronic
952005766 3:28840892-28840914 TTTTCAGCCCCTTGGTGGCAAGG + Intergenic
952929515 3:38348141-38348163 GTCTCAGGCCTCTGCAGACATGG + Intronic
953323022 3:41989121-41989143 ATCTCAGCACTTTGGAGGCAAGG - Intergenic
953433482 3:42858627-42858649 ATCACAACTCCTTGCAGGCAAGG + Intronic
953719220 3:45340685-45340707 GCCTCGGCCCCTTGCAGATAGGG + Intergenic
955200826 3:56850748-56850770 GTGTGAGCCCCTTGAAGGCCTGG - Intronic
955397281 3:58566329-58566351 CTCTGAACCCCTTGCAGGGAGGG + Exonic
959521668 3:107328681-107328703 GTCTGAGCCCACTGCAGCCATGG - Intergenic
961439844 3:126946110-126946132 ATGGCAGCCCCTTGCAGCCATGG - Intronic
961479472 3:127170850-127170872 GACCCAGACCCTGGCAGGCAGGG - Intergenic
961669463 3:128518408-128518430 GTCTCAGCCACTTGCTGGTCAGG - Intergenic
961750325 3:129090584-129090606 GCCCCAGCCCCTTCCAGGCGGGG - Exonic
962669798 3:137693393-137693415 GTCTCAGCACTTTGCTGACAGGG - Intergenic
962917587 3:139918611-139918633 GTGTAAGCCCCTTGAGGGCAGGG - Intergenic
963604834 3:147405274-147405296 GTCTCAGCCGCCTGCAGGTTGGG - Intronic
965263365 3:166510955-166510977 GTCTCAGCCCCTAGCGGGAGGGG + Intergenic
965984234 3:174732556-174732578 CTCTGAGCCTCTTGAAGGCAAGG - Intronic
968155952 3:196380798-196380820 GTCTTAGCAACTGGCAGGCAAGG + Intronic
968280304 3:197472076-197472098 GTCTCAGCCTCATGGTGGCAGGG - Intergenic
968912371 4:3482862-3482884 GGCTGAGCACCTTGCCGGCAGGG - Intronic
969129849 4:4983345-4983367 GTCTCAGCTCCCTGCAGGTTGGG - Intergenic
969367420 4:6705448-6705470 ATGTCAGCCCCTTGAGGGCAGGG - Intergenic
970193647 4:13536553-13536575 TTCCCAGGCCCCTGCAGGCAGGG - Intergenic
971303823 4:25463379-25463401 ATATAAGCTCCTTGCAGGCAGGG - Intergenic
972109424 4:35538985-35539007 GTCTCAGCTACTTACAGGGATGG - Intergenic
972388596 4:38591572-38591594 TTCTGAGCTCCTTGAAGGCAAGG + Intergenic
974122502 4:57656550-57656572 TTGTAAGCTCCTTGCAGGCAGGG + Intergenic
975924433 4:79432067-79432089 GGCTCAGCTCCATGCATGCAAGG - Intergenic
980787386 4:137572727-137572749 GCCTGAGCCCCTAGCAGGAAGGG - Intergenic
981718622 4:147776812-147776834 GTCTCAGCCTCCAACAGGCAAGG - Intronic
983203046 4:164883053-164883075 TTCTTACCCCCTTGCAGTCATGG + Intronic
984372525 4:178885022-178885044 GTCACAGCTCCTTGCCAGCAAGG + Intergenic
984930065 4:184839176-184839198 GTTTCAGCTCCTTGAAGGCATGG - Intergenic
985629492 5:1007330-1007352 CTCTGAGCCCATCGCAGGCACGG + Intergenic
987060024 5:14233650-14233672 GCCTCAGCCTCCTACAGGCATGG + Intronic
988989544 5:36656289-36656311 AGCTCAGCCCCTTGCTAGCAGGG - Intronic
989610257 5:43284024-43284046 GTGGCTGCCCATTGCAGGCAGGG - Intergenic
994615524 5:102099800-102099822 CTCTCAGCTCCTCGCAGGCAGGG + Intergenic
995056646 5:107766577-107766599 TTATCAGTCCCTTGCAGCCAGGG + Intergenic
995599095 5:113776521-113776543 GTCTTTTCCCCTTCCAGGCAGGG + Intergenic
996629168 5:125607067-125607089 CTCTCAGCCCCTGGCTGGCTAGG + Intergenic
997153510 5:131526114-131526136 GACTGAGCTCCTTGAAGGCAGGG - Intronic
997200448 5:132006851-132006873 GTGTAAACTCCTTGCAGGCAGGG - Intronic
997232743 5:132256276-132256298 TGCTCAGCCCCTTGCAGACTTGG - Intronic
1000012568 5:157246286-157246308 ATATGAGCCCCTTGAAGGCAGGG + Intronic
1001335850 5:170795957-170795979 GTCTCTGCCACCTGCAGCCATGG + Intronic
1002322381 5:178383489-178383511 GTCTCTGCCACCTGCAGGCCTGG + Intronic
1002896448 6:1382917-1382939 CTCTCAGCGCCTTGGAGTCAGGG + Intergenic
1003193260 6:3892581-3892603 TTCTCAGCCTCTTGCAGCCAGGG + Intergenic
1003405374 6:5823452-5823474 GTATGAACCCCCTGCAGGCAGGG + Intergenic
1007923121 6:45628701-45628723 GTCTCAGCCCCTAGTAGGGGAGG + Intronic
1008466053 6:51832121-51832143 CTATCAGCTCCTTGGAGGCAAGG - Intronic
1014190176 6:118486994-118487016 CTCTAAGCTCCTTGAAGGCAGGG - Intronic
1014216351 6:118755938-118755960 GTCACAGCCCACTCCAGGCAAGG + Intergenic
1015485556 6:133766218-133766240 TTATCAGCTCCTTGAAGGCAGGG - Intergenic
1017042830 6:150321758-150321780 TTCTCAGCCCCTCCCATGCAGGG + Intergenic
1017071138 6:150576457-150576479 GTGTAAGCCCCGTGAAGGCAGGG - Intergenic
1017766049 6:157608329-157608351 CTCTAAGCTCTTTGCAGGCAGGG - Intronic
1018923299 6:168190365-168190387 GTGGCCGACCCTTGCAGGCAGGG - Intergenic
1019301415 7:305974-305996 GACCCAACCCCTTGCAGGCGCGG + Intergenic
1019459753 7:1151263-1151285 GTCCCAGCCCCTTGGAGGTCAGG + Intergenic
1019985495 7:4652454-4652476 GTCCCAGCTCCTGGCAGCCATGG + Intergenic
1020431554 7:8121019-8121041 TTATCTACCCCTTGCAGGCATGG - Intronic
1022389293 7:29929315-29929337 GGCTCAACACCTGGCAGGCAAGG + Intronic
1024471067 7:49769270-49769292 GTCTCAACCTCTTTCAGGCATGG + Intergenic
1025143382 7:56484010-56484032 TTCTCAGCCCGTTGGTGGCAAGG + Intergenic
1025996068 7:66528275-66528297 GTCTCAGCCCCTTGCAGGCAGGG - Intergenic
1026987710 7:74565109-74565131 GTCTCAGCCCCTTGCGGGCAGGG - Intronic
1027492564 7:78847846-78847868 ATCTAAGCTCCTTGAAGGCAGGG + Intronic
1027972395 7:85102038-85102060 CTGTGAGCCCCTTGCAGACAAGG - Intronic
1029734006 7:102455577-102455599 GTCTCTGCCCCTGACAGGCTGGG - Exonic
1030939949 7:115633600-115633622 GTCACAGCCCCTACCAGGCCAGG + Intergenic
1031494956 7:122434605-122434627 TCTTCAGCCCCATGCAGGCAGGG - Intronic
1032264368 7:130360708-130360730 CTGTAAGCCCCTTGAAGGCAGGG - Intronic
1032275595 7:130452529-130452551 CTATCAGCTCCTTGAAGGCAGGG + Intergenic
1032411235 7:131694425-131694447 GTGGGAGCCCCCTGCAGGCAGGG - Intergenic
1033713127 7:143969949-143969971 ATATAAGCCCCTTGAAGGCAGGG + Intergenic
1034672528 7:152869357-152869379 CCCTCAGCACCTTGCAGGTATGG + Intergenic
1041620613 8:59963845-59963867 GTCTCAGGGCCTGGCAGGTAAGG - Intergenic
1041767211 8:61431681-61431703 GTATAAGCTCCTTGAAGGCAGGG + Intronic
1042432819 8:68727759-68727781 GCATCAGCCCCTTTCAGCCATGG + Intronic
1045299499 8:100899112-100899134 TTCTCAGCTCCTTCAAGGCAAGG - Intergenic
1045491102 8:102670127-102670149 GTCTCAGCGTCTTGAAGGAAAGG - Intergenic
1047174289 8:122525920-122525942 CTCTCTGCACCCTGCAGGCATGG + Intergenic
1047923896 8:129663682-129663704 ATCTCAGCCCATTGCAGCCTGGG - Intergenic
1048982187 8:139708533-139708555 CTTTCAGCTCCTTGAAGGCAGGG + Intergenic
1049034954 8:140068113-140068135 GTCTGAGCTCCTTACAAGCAAGG + Intronic
1049498367 8:142947325-142947347 GTGTCAGCCCATGGCAGGCTGGG - Intergenic
1049712829 8:144073999-144074021 ATGTCAGCCCCTTCCAGGGAGGG + Intergenic
1052781936 9:32790458-32790480 GTGTGAGCTCCTTGAAGGCAGGG + Intergenic
1052862473 9:33445581-33445603 GTCTGAGCCTTTGGCAGGCAAGG - Intronic
1057686363 9:97238246-97238268 GTCCCCGCCCCTAGCAGCCATGG - Intergenic
1057914798 9:99047512-99047534 GACCCAGCCCCTCGCAGTCAGGG - Intronic
1058081855 9:100709490-100709512 ATCTCAGCTCCTTGCCAGCAAGG - Intergenic
1058331183 9:103762703-103762725 TTCTAAGCTCCTTGCAGGTAAGG + Intergenic
1059781856 9:117537910-117537932 GACTCAGCCCCTTGCATTCATGG + Intergenic
1060554334 9:124500514-124500536 GGCTCAGGCCCATGCAGGCTGGG + Exonic
1061012052 9:127961561-127961583 GTATAAGCCCCTTGAAGGCAGGG - Intronic
1061586806 9:131574966-131574988 GACACAGCCCTTTGCAGCCAAGG + Intergenic
1061857608 9:133450861-133450883 GTTTAAGCACCATGCAGGCAGGG + Intronic
1061960612 9:133987112-133987134 GTCTGAGCCCCTCCAAGGCAGGG - Intronic
1062179301 9:135182304-135182326 GTCTCTGTCCCCTGCAGGCTTGG - Intergenic
1186460223 X:9742562-9742584 GAATCAGTACCTTGCAGGCAGGG - Intronic
1186497878 X:10026253-10026275 GCCTCAGCCAATTGCAGGCCCGG - Intronic
1187009086 X:15261955-15261977 CCCTCAGCCCCTGGCAGCCATGG + Intronic
1187504933 X:19871831-19871853 GTCCAAGTCCCTTGCTGGCAAGG - Intronic
1187584000 X:20639744-20639766 TTCTAAGCCCCTTGAGGGCAAGG + Intergenic
1187676769 X:21723977-21723999 GTCAGAGCCCCTGGCTGGCAGGG - Intronic
1188772126 X:34165291-34165313 GTCTTGGCATCTTGCAGGCATGG - Intergenic
1189185800 X:39053724-39053746 CTCTGAGGCCCTTGAAGGCAAGG - Intergenic
1189604977 X:42667471-42667493 CTCTAAGCCCCTTGAAGGCAGGG - Intergenic
1194655354 X:96566683-96566705 GTATAAGCTCCTTGAAGGCAGGG - Intergenic
1195010582 X:100729553-100729575 ACCTCAGCCCCTTGAAGGAATGG + Intronic
1196790015 X:119456189-119456211 GTGTAAGCTCCTTGAAGGCAAGG - Intergenic
1198740724 X:139839537-139839559 CTCTAAGCTCCTTGAAGGCAAGG - Intronic
1199678985 X:150212524-150212546 ATGTCAGCTCCTTGAAGGCAGGG + Intergenic
1200926334 Y:8658251-8658273 CACTCAGCCCCTTTCAGGAATGG + Intergenic