ID: 1025996069

View in Genome Browser
Species Human (GRCh38)
Location 7:66528276-66528298
Sequence TGTCTCAGCCCCTTGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996069_1025996071 -3 Left 1025996069 7:66528276-66528298 CCTGCCTGCAAGGGGCTGAGACA 0: 1
1: 1
2: 3
3: 30
4: 304
Right 1025996071 7:66528296-66528318 ACAACCCACGCTCGACCCTGAGG No data
1025996069_1025996076 12 Left 1025996069 7:66528276-66528298 CCTGCCTGCAAGGGGCTGAGACA 0: 1
1: 1
2: 3
3: 30
4: 304
Right 1025996076 7:66528311-66528333 CCCTGAGGGCTGAACACCATTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1025996069_1025996072 -2 Left 1025996069 7:66528276-66528298 CCTGCCTGCAAGGGGCTGAGACA 0: 1
1: 1
2: 3
3: 30
4: 304
Right 1025996072 7:66528297-66528319 CAACCCACGCTCGACCCTGAGGG 0: 1
1: 1
2: 0
3: 2
4: 46
1025996069_1025996078 19 Left 1025996069 7:66528276-66528298 CCTGCCTGCAAGGGGCTGAGACA 0: 1
1: 1
2: 3
3: 30
4: 304
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996069 Original CRISPR TGTCTCAGCCCCTTGCAGGC AGG (reversed) Intergenic
900903949 1:5537446-5537468 TGTCTCAGCCTCTTACAGAAAGG - Intergenic
901321517 1:8343136-8343158 TCACGCAGCACCTTGCAGGCCGG + Intronic
901605884 1:10458880-10458902 TGTCTCACTCTGTTGCAGGCTGG + Exonic
902057826 1:13617109-13617131 TGTCTCAGCACCATCCAGCCTGG + Exonic
902773554 1:18660215-18660237 TGGCTCTGCCACTTGCTGGCTGG + Intronic
902836069 1:19047551-19047573 TGTCTGGCCCCCTTCCAGGCTGG - Intergenic
902967078 1:20013007-20013029 TGTCTCTGCCCCCTGCAGATTGG - Intergenic
904203681 1:28838538-28838560 TGTCTCACCCCCATGGTGGCAGG + Intronic
904205618 1:28853195-28853217 TTTCTCAACCCCTTGCAGTTGGG + Intronic
904603076 1:31684187-31684209 TGTCACTGTCCCCTGCAGGCTGG + Exonic
905452871 1:38068321-38068343 TGTCTCCCTCCCTTGCGGGCTGG + Intergenic
905921338 1:41721319-41721341 TGTCTCAGCCCCGAGTAGGTGGG + Intronic
906057563 1:42928840-42928862 TGTCTCAGCCCCAGGCTGGCAGG - Intronic
906225599 1:44118997-44119019 GGTGCCAGCCCCTGGCAGGCCGG + Intronic
906529828 1:46517326-46517348 TCTCTCAGCCCCTCCCAGGGAGG - Intergenic
907933694 1:59022966-59022988 TGTATCTGTCCTTTGCAGGCAGG + Intergenic
909928513 1:81467541-81467563 AGTCTCAAACCCTTGCATGCAGG + Intronic
910035913 1:82788621-82788643 TGTCTAAGCTCCTTGAAGGCAGG + Intergenic
911614121 1:99989877-99989899 TGCCTCAGCCTCTTGAATGCTGG + Intronic
912078979 1:105912094-105912116 TCTCTCTGCCACTTGCAGGAAGG - Intergenic
916042922 1:160976912-160976934 TGTCTCAGCTCACTGCAGCCTGG + Intergenic
916057795 1:161079945-161079967 CCTCTCTGCCCCCTGCAGGCCGG - Exonic
916830169 1:168482712-168482734 TGTCTCACCTCCTTGCAGCTAGG + Intergenic
917195075 1:172456262-172456284 GGTCTCAGCCCCATCCAGGGTGG - Intronic
919240906 1:194914676-194914698 TATCTCAGCCCCTTGTGGGAGGG - Intergenic
919824784 1:201495738-201495760 TTCCTCAGCCCCTTGCAGGCTGG - Intronic
920392623 1:205618966-205618988 TGTGTTAGCACCTTGCAGTCTGG + Exonic
920454064 1:206084554-206084576 TGTCTGAGCCCCTCCCAGGTTGG - Intronic
922769234 1:228173226-228173248 TGGCCCAGCCCCTTCCAGCCAGG - Intronic
923255850 1:232220770-232220792 TGTGTAAGCTCCTTGAAGGCAGG - Intergenic
923892751 1:238234497-238234519 TTTCTGACCCCTTTGCAGGCAGG + Intergenic
1062769220 10:86237-86259 CAGCCCAGCCCCTTGCAGGCTGG - Intergenic
1063131954 10:3185811-3185833 GCTCTCAACCCCTTGCAGGATGG - Intergenic
1063537613 10:6900591-6900613 GCACTCAGCCCCTTGCAGGAGGG + Intergenic
1063988359 10:11532787-11532809 TGTTTCAGCCCGTTTCAGACAGG + Intronic
1064130544 10:12705719-12705741 TGTCTCAGCCCTTGGCAAGAAGG - Intronic
1069194263 10:65528814-65528836 TGTCTCAGCACTTTTCAGGAGGG - Intergenic
1069603508 10:69724917-69724939 TGTCTCAGCTTCTTACTGGCTGG + Intergenic
1071504638 10:86225173-86225195 TTTCCCAGCCCCTCCCAGGCCGG + Intronic
1073972613 10:109061488-109061510 AGTCTCCACCCCTTGCAGGAGGG - Intergenic
1076014515 10:127016546-127016568 TGTCTCAGTTCCTTCCACGCAGG + Intronic
1076356719 10:129858580-129858602 TGTCTCAGCCCCAGGCACCCAGG - Intronic
1076420811 10:130330432-130330454 TGTCTCCATCCCCTGCAGGCGGG - Intergenic
1076645393 10:131950655-131950677 TGTCTCAGCCCCTTTCTGCAGGG - Intronic
1076702783 10:132282925-132282947 TGTCACAGCCCCTCTGAGGCTGG + Intronic
1077445920 11:2590793-2590815 TGGCCCAGTCCCTTGGAGGCTGG + Intronic
1078642195 11:13107193-13107215 TATCTCTGCCCCTTGAGGGCAGG - Intergenic
1078720530 11:13879805-13879827 TGTTTCAGGCCTTTTCAGGCTGG + Intergenic
1080445634 11:32334781-32334803 AGGCTCAACCCCTTGCAGGAGGG + Intergenic
1080526411 11:33125598-33125620 TTTCTCAGTCCCTTACAGGTAGG + Intronic
1081258774 11:40932016-40932038 AGTCTCAGCCCCTTGAGGTCAGG - Intronic
1081747829 11:45485367-45485389 TGACTCAGCCTCTTACAGACTGG + Intergenic
1081773573 11:45664031-45664053 TTCCTCAGCCCCTTGCAGTGGGG - Intronic
1082759816 11:57116636-57116658 TGTCCCTGCCACTTGCTGGCTGG - Intergenic
1082797614 11:57389307-57389329 AGTCTCAGACCCTGGCAGGGAGG + Exonic
1082802878 11:57427170-57427192 TGCCCCAGCCCCTTCCGGGCGGG - Intronic
1082991758 11:59212709-59212731 TGTCCCAGCCCCCTCCAGGTAGG + Exonic
1083063647 11:59900177-59900199 AGTCCCAGCTCCTTGCAGGTGGG + Intergenic
1083144270 11:60747015-60747037 TGTCTCATCCTCCAGCAGGCTGG + Intergenic
1083772705 11:64877503-64877525 TGGGGCAGCCCCTTGGAGGCAGG - Intronic
1084694053 11:70743455-70743477 TTTCTCAGCCCTCTGGAGGCTGG - Intronic
1085816695 11:79744890-79744912 TGTCCCAGGGCCTGGCAGGCAGG - Intergenic
1086493333 11:87377603-87377625 TGGCTCAGCCCCTTGAAGGAGGG + Intergenic
1087655600 11:100919134-100919156 TGCCACAGCTCCTTGCAGGGGGG - Intronic
1087829903 11:102808186-102808208 TGTCTCAGCTATGTGCAGGCTGG + Intergenic
1087845313 11:102965139-102965161 GCTCTCAACCCCTTGCAGGAAGG - Intergenic
1088501492 11:110487607-110487629 TGCCTCAGCCCCCTGAGGGCTGG - Intergenic
1088974419 11:114803083-114803105 TGGCTGAGCCTGTTGCAGGCAGG - Intergenic
1089282187 11:117382176-117382198 TGCTCCAGCCCCTTGCAGGGAGG - Intronic
1089565290 11:119368069-119368091 TGTCTCCATCCCTTGCAGACCGG - Intronic
1090106146 11:123855057-123855079 TTTCTGTGCCCCTGGCAGGCTGG - Intergenic
1090740295 11:129653974-129653996 CATCTCAGCCCCTTGGTGGCAGG - Intergenic
1095983241 12:47984403-47984425 TGGCTGAGCCCCATGCTGGCTGG - Intronic
1097226328 12:57478702-57478724 TGTCTCAGGCCCTCCCAAGCAGG - Exonic
1097494606 12:60315089-60315111 TGTATCAGCCTCTGGCAGCCTGG + Intergenic
1097503660 12:60438026-60438048 GCTCTCAACCCCTTGCAGGAGGG + Intergenic
1098647160 12:72917725-72917747 TGCCTCAACCCCTTGCAGCTGGG + Intergenic
1100757881 12:97772663-97772685 GCTCTCAACCCCTTGCAGGAGGG + Intergenic
1100876841 12:98971089-98971111 TAACTCTGCCCCTTGCTGGCTGG + Intronic
1101759370 12:107646231-107646253 TGTTTCACCCCCTTGCAGAAAGG + Intronic
1102015452 12:109645150-109645172 TGTCTCAGACCCTTATATGCAGG - Intergenic
1102511991 12:113422147-113422169 TGTCTCTGCCCCTTGCTGTCTGG + Intronic
1102570094 12:113822290-113822312 TGGCACAGGCCCTTCCAGGCGGG + Intronic
1102817706 12:115881154-115881176 TGGCTCCACCCCTTGCAAGCTGG + Intergenic
1103148919 12:118620027-118620049 TGTCTCCTCCCTTTCCAGGCAGG + Intergenic
1103521567 12:121539455-121539477 TGCCTCAGCTCCTTGAAGGCAGG + Intronic
1103809401 12:123601823-123601845 TTTCTCTGCCCCTCGGAGGCAGG - Intergenic
1104533287 12:129593471-129593493 GGTCTCAGACACTTGAAGGCTGG + Intronic
1108118658 13:47160027-47160049 TCTCTCACCCCCTTTCAAGCTGG + Intergenic
1108612578 13:52098195-52098217 TGTCTCAGCTCACTGCAGCCTGG - Intronic
1108731840 13:53243246-53243268 ACTCTGAGCTCCTTGCAGGCAGG + Intergenic
1109527788 13:63598988-63599010 TGTCTCAGCCCCTGAGAGACAGG - Intergenic
1110071271 13:71182236-71182258 GCTCTCAACCCCTTGCAGGAGGG + Intergenic
1111572710 13:90107880-90107902 TGACCCACCCCCTTGCTGGCGGG - Intergenic
1112746266 13:102530714-102530736 AATCTCAGCCCCATGCTGGCTGG + Intergenic
1113184684 13:107674595-107674617 AGTCTCAGCCCCTTGAGGACAGG - Intronic
1114885585 14:26845699-26845721 CTTCTCAGACACTTGCAGGCTGG + Intergenic
1115768453 14:36647217-36647239 AGTCTCAGCGCCTGCCAGGCGGG + Intergenic
1116685727 14:48036007-48036029 TGTCTCAGCTCCTTGTGGGAGGG - Intergenic
1116961372 14:50971596-50971618 TGTCTCAGGCCCCATCAGGCAGG - Intergenic
1118714604 14:68550067-68550089 TTTCTCACCCCTCTGCAGGCAGG + Intronic
1119437018 14:74604314-74604336 AGTCTCAGCCCCCGGCAGTCTGG + Intronic
1119570142 14:75662633-75662655 GGTTTAAGACCCTTGCAGGCCGG - Intronic
1119725310 14:76918675-76918697 TGTCTCAGCCCCTTTTTGGGTGG + Intergenic
1120434193 14:84459425-84459447 TGTATCAGCACTTTGCAGGTTGG - Intergenic
1120812461 14:88818198-88818220 TGTCTCAGCCTATTGCACTCAGG + Intergenic
1121136466 14:91503398-91503420 TGCCTCAGCCCCAAGCAGCCGGG + Intronic
1122920961 14:104879932-104879954 AGGCCCTGCCCCTTGCAGGCTGG - Intronic
1124413391 15:29455142-29455164 AGTCTCATCCCCCAGCAGGCTGG - Intronic
1125530424 15:40409667-40409689 TGTCTCAGCCACTTGGAGTTTGG + Intronic
1126759155 15:51953504-51953526 TGTCTCAGCCTCCCGAAGGCTGG - Intronic
1127462996 15:59216998-59217020 GGTCTCAGCCCCTTGCTGCATGG - Intronic
1129028062 15:72597781-72597803 TTTCACAACCCCTTGGAGGCTGG - Exonic
1129136499 15:73557097-73557119 TGCCTCAGCACCCAGCAGGCTGG + Intronic
1129781684 15:78276510-78276532 CTTCTCAGCCCCTTCTAGGCAGG - Intronic
1130325685 15:82877928-82877950 TGGCTCAGCCCCAAGCAGGGTGG + Intronic
1132107454 15:99073558-99073580 TGTCCCAGCCTCTTGCAGTTGGG - Intergenic
1132379115 15:101353832-101353854 AGGCTCTGCCCCTTCCAGGCAGG + Intronic
1132458327 16:36483-36505 CAGCCCAGCCCCTTGCAGGCTGG - Intergenic
1134124609 16:11607959-11607981 TGTCCCAGCTCCCTGAAGGCAGG + Intronic
1134820905 16:17246732-17246754 TGTCCTAGCCCCGTGCAGGCAGG + Intronic
1137028982 16:35505338-35505360 TGCCTCAGCTCCCTGCAGGGTGG - Intergenic
1137237207 16:46625893-46625915 AGCCCCAGCCCCTTCCAGGCGGG - Intergenic
1137446886 16:48537373-48537395 TTTCTCAGCACCCTGCAGGCAGG + Intergenic
1137734958 16:50716932-50716954 TGGCTAAGCTCCTTGCATGCAGG + Exonic
1138152483 16:54671417-54671439 TATCTCAGCCTCCTGAAGGCTGG - Intergenic
1138305223 16:55968521-55968543 TGCCTGACCCCATTGCAGGCTGG + Intergenic
1141186476 16:81791136-81791158 TGTCTCCCCCTCTTGCAAGCTGG - Intronic
1141669057 16:85481993-85482015 GGACTACGCCCCTTGCAGGCGGG + Intergenic
1141701092 16:85642480-85642502 TGTCTCAGCCCCTTGGAAGGAGG - Intronic
1142006787 16:87693021-87693043 GTTCTCTGCCCCCTGCAGGCTGG + Intronic
1142025726 16:87812442-87812464 TGTCTCAGGCCCCAGCAGCCTGG - Intergenic
1142157500 16:88539320-88539342 GCTCAAAGCCCCTTGCAGGCTGG + Intergenic
1142480444 17:215473-215495 TCTCTCTGTTCCTTGCAGGCAGG + Intronic
1142742132 17:1937394-1937416 GGGCTCAGCGCCTTGCCGGCCGG - Exonic
1142911533 17:3097709-3097731 TGTTTGAGCTCCTTGCAGGAGGG + Intergenic
1143432024 17:6894538-6894560 GGGCACAGCCCCTGGCAGGCTGG + Intronic
1144717837 17:17446746-17446768 CTGCTCAGCCCCATGCAGGCTGG + Intergenic
1144786368 17:17834556-17834578 AGTCCCAGCCCCTTGAAGACTGG - Intronic
1147457628 17:40548023-40548045 GGTCACAGCCCCTGGCAGGTGGG + Intergenic
1148682786 17:49484265-49484287 CCTCACAGCCCCCTGCAGGCAGG - Intergenic
1150474841 17:65467049-65467071 TGTCTCGGCCACTTGCCAGCTGG + Intergenic
1151757009 17:76080790-76080812 TGGCTCGGCCCCTTGCAGCAAGG + Intronic
1152335865 17:79700018-79700040 TGACTCAGTCCCCTCCAGGCAGG - Intergenic
1152779522 17:82220058-82220080 TGGCTCAGCCCTTTGGAGGCTGG - Intergenic
1152801062 17:82330876-82330898 GGTCTCAGCCCCTGGCGGCCTGG + Intronic
1152862132 17:82702729-82702751 TGGCTCAGCTACTTCCAGGCCGG - Intergenic
1203168539 17_GL000205v2_random:123161-123183 TGTCTCAGCCAATAGCATGCAGG + Intergenic
1152962293 18:87039-87061 CAGCCCAGCCCCTTGCAGGCTGG - Intergenic
1157731702 18:50009850-50009872 TGTCTCAGGCACCTGGAGGCAGG + Intronic
1158190654 18:54824683-54824705 TTTCTTAGCCCCTTGCAGGTGGG - Intronic
1158499017 18:57983366-57983388 TGTCTCAGCTTCATCCAGGCTGG - Intergenic
1159014944 18:63093691-63093713 TTTCTCTGCCACTTGCAGGTAGG - Intergenic
1159869187 18:73741205-73741227 GGTCCCAGTCCCTTACAGGCAGG + Intergenic
1160300640 18:77674600-77674622 TGTCACAGCCCTGTGCAGGAAGG - Intergenic
1161564740 19:4995298-4995320 GGTCTCACCCACTTGGAGGCAGG + Intronic
1162575653 19:11497399-11497421 TGGCTCTGCCCCTTCCAAGCTGG + Intronic
1163084764 19:14971465-14971487 ATACTAAGCCCCTTGCAGGCTGG + Intronic
1163157492 19:15447469-15447491 AGTGTCAGCCCCTTGAGGGCAGG + Intronic
1164460801 19:28445887-28445909 TGTCTTTCCCCCTTCCAGGCAGG - Intergenic
1165093504 19:33398300-33398322 AGGCTCAGCCCCTTGCAGCCTGG + Intronic
1165913657 19:39244853-39244875 TGTGGCAGCCCCTTGCATCCGGG + Exonic
1165917305 19:39268771-39268793 TGTGGCAGCCCCTTGCATCCGGG - Exonic
1166117766 19:40666526-40666548 TGACTCAGCACCTGCCAGGCGGG - Exonic
1166850382 19:45757291-45757313 TGTCTCTCCTCCTTGTAGGCTGG + Intronic
1167112591 19:47470988-47471010 TGTCTCCGCCCCTGGCAGGGGGG - Intronic
1167158841 19:47755052-47755074 TTTCCCAGCCTCTTCCAGGCAGG + Intronic
1167824194 19:51957060-51957082 TGTATTAACCCCATGCAGGCTGG + Intergenic
1168145647 19:54418961-54418983 GGTCCCAGCCCCTCCCAGGCTGG - Intronic
925051865 2:821754-821776 TGGCTCAGCGGCCTGCAGGCTGG + Intergenic
926039520 2:9661671-9661693 AGTCCCAGCCCCTTCCAGGCAGG - Intergenic
930482864 2:51971436-51971458 TCTCTCATCCCCCAGCAGGCTGG + Intergenic
930818484 2:55622030-55622052 GGCCTCAGCCCCTGGCAGGAGGG - Intergenic
934660155 2:96138856-96138878 TTTCTCTGCCCCCTGGAGGCAGG - Intergenic
935666822 2:105519312-105519334 TGTCTCAGCCACCTGCTGCCTGG + Intergenic
935680545 2:105632864-105632886 TGTCCCATCCCCTTGCTGTCTGG - Intergenic
936868711 2:117107994-117108016 AGTCTCAACTCCTTGCAGGAAGG - Intergenic
937229744 2:120390655-120390677 TGTCCCTTCCCCTTGCAAGCTGG - Intergenic
937296916 2:120815002-120815024 TGTCTCAGGCCCGTGGACGCTGG - Intronic
938089479 2:128421922-128421944 GTTCTCAGCCCCTTGCAGGAGGG + Intergenic
938169031 2:129058481-129058503 TGTGCCAGCCCCTCGCAGGCTGG + Intergenic
938576394 2:132608419-132608441 TGTGTCAGCTCCTTGCTGTCGGG + Intronic
940467308 2:154047471-154047493 TGGCTCAGCCTCTTGGAAGCTGG + Intronic
940855892 2:158728508-158728530 TGTCTCCTCCCCATGCCGGCAGG - Intergenic
943098572 2:183458664-183458686 TGGCTCAGCCCTGTGCAGGGCGG + Intergenic
945269613 2:207925030-207925052 TGACGTGGCCCCTTGCAGGCTGG - Intronic
945606223 2:211935617-211935639 TGGCTCAGCACCTCGGAGGCTGG - Intronic
945868552 2:215202919-215202941 ACTCTCAACCCCTTGCAGGAGGG + Intergenic
946147617 2:217742920-217742942 TGGCTCTGCCTCTTGCTGGCTGG - Intronic
946907489 2:224430557-224430579 ATGCTCAGCCCCTTGCAGGAAGG - Intergenic
947141733 2:227025383-227025405 TGTCACAGCCCCTTACTGGGAGG + Intronic
947806692 2:232973601-232973623 TCTCTCATCCCCCAGCAGGCTGG - Intronic
948019715 2:234720518-234720540 AGTCTCAGCCCCTTCCCCGCAGG + Intergenic
948107508 2:235427435-235427457 TGGCTCTGCCCCTCACAGGCGGG + Intergenic
948241916 2:236445009-236445031 TCTCTAAGCCCCGTCCAGGCTGG - Intronic
948378444 2:237537436-237537458 TTTCTCAGCCCCATGCACTCTGG + Intronic
948569326 2:238907419-238907441 TGTCTCCTCCCCCTGCAGGTGGG + Intronic
948666730 2:239539332-239539354 TGTCTCAGCATCCTGCAGGCTGG - Intergenic
948869132 2:240789539-240789561 TGACACAGAGCCTTGCAGGCTGG - Intronic
1170864740 20:20143207-20143229 TGTCTCAGCCTCCTGAAGTCAGG - Intronic
1171981176 20:31630410-31630432 TGTCTCTGCCCCATGAAGTCTGG + Intergenic
1172765145 20:37346781-37346803 TGGCCCAGTCCCTTCCAGGCCGG - Intronic
1175242724 20:57561657-57561679 TGTCCCAGCACCCTGCAGGCAGG + Intronic
1175366990 20:58462335-58462357 GGTCTCTGCCACTTCCAGGCTGG - Intronic
1175843206 20:62043913-62043935 TTTCTAAGCCCACTGCAGGCTGG + Intronic
1177862523 21:26471015-26471037 TCCCTCAGACCCTTGGAGGCTGG + Intronic
1178499915 21:33117262-33117284 TGGCTCAGCCACTTGCAGTCCGG - Intergenic
1178711036 21:34916969-34916991 TGGCTCTGCCACTTGCTGGCTGG - Intronic
1180670511 22:17549018-17549040 TGTCTCACAGCCTTGCAGACTGG - Exonic
1181030583 22:20147368-20147390 GGTCTCAGGCCCTGGCAGGCTGG - Exonic
1181512726 22:23396013-23396035 GGTCTCAGGCGCTGGCAGGCTGG + Intergenic
1181940220 22:26470107-26470129 TGTCACAGCCCAGGGCAGGCAGG - Intronic
1182394602 22:30026330-30026352 TGGCTCAGCTCCTCGCAGGAGGG - Exonic
1182576806 22:31278445-31278467 TGGCCCAGCCCCCTGCAGGGGGG + Intronic
1182675243 22:32034202-32034224 TGTCTCAGCCCCCTGAGTGCTGG + Intergenic
1183172232 22:36197027-36197049 TGCCTCTGTCCCCTGCAGGCTGG + Intronic
1184117907 22:42432618-42432640 TGTCTCGGCCCCTTTCCAGCAGG + Intergenic
1184671491 22:46014175-46014197 GGTCTCAGCCCCCTCCAGACTGG + Intergenic
949483016 3:4511770-4511792 CCTCTCAGCCCATGGCAGGCAGG - Intronic
949900442 3:8810421-8810443 TGTCTCAGCCTCCTGAGGGCTGG - Intronic
950656832 3:14441733-14441755 GGCCTCAGGGCCTTGCAGGCAGG - Intronic
952372312 3:32735229-32735251 TGCCTCAGCCTTTTACAGGCAGG - Intronic
958520008 3:95172270-95172292 TGGCTCAGCCCTCTACAGGCTGG - Intergenic
959716424 3:109438622-109438644 TGTCTCAGCCTCTTGGTAGCTGG + Intergenic
961253226 3:125523892-125523914 TGTCACAGTCCCTGGGAGGCTGG - Intergenic
961750326 3:129090585-129090607 AGCCCCAGCCCCTTCCAGGCGGG - Exonic
962669799 3:137693394-137693416 TGTCTCAGCACTTTGCTGACAGG - Intergenic
962832779 3:139158877-139158899 ATTCTCAGTCCCTTGCAGTCAGG - Intronic
963604835 3:147405275-147405297 TGTCTCAGCCGCCTGCAGGTTGG - Intronic
963733594 3:148994298-148994320 TGTCAGAGCCCCTTGGATGCTGG - Intronic
965263364 3:166510954-166510976 GGTCTCAGCCCCTAGCGGGAGGG + Intergenic
967241294 3:187442077-187442099 TGGCTCAGCCTCTTACAAGCTGG + Intergenic
969129850 4:4983346-4983368 TGTCTCAGCTCCCTGCAGGTTGG - Intergenic
971322010 4:25613247-25613269 TGGCTGAGCCCCCTGGAGGCAGG + Intergenic
972266836 4:37468447-37468469 TAACACAGCCCTTTGCAGGCTGG - Intronic
974122501 4:57656549-57656571 TTTGTAAGCTCCTTGCAGGCAGG + Intergenic
974415376 4:61599751-61599773 TGTCTCAGTCCCATTCATGCTGG - Intronic
975559549 4:75696183-75696205 TCTCTTAACCCCTTGCAGTCTGG - Intronic
980081694 4:128351051-128351073 ATGCTCAGCCCCTTGCAGGAGGG - Intergenic
980861903 4:138509098-138509120 TGTCACATCCCCTTTCAGGTGGG - Intergenic
985170749 4:187147290-187147312 TTTCTCAGCCCCTTGCTGTGTGG + Intergenic
986482043 5:8199230-8199252 TGTCTCATCCCATTGTAGGCTGG + Intergenic
989147748 5:38265356-38265378 TGCCTCACACCCTGGCAGGCCGG + Intronic
990468406 5:56090703-56090725 TCTCCCAGCCCCTTGCAGTGAGG - Intergenic
990835395 5:60013873-60013895 GGTCTCGGTCTCTTGCAGGCTGG - Intronic
991655552 5:68900752-68900774 TGTCTCTGCCACTTGCCAGCTGG - Intergenic
992713460 5:79485019-79485041 TTTCTCAGCCCCCAGCAGACTGG - Intronic
994615523 5:102099799-102099821 GCTCTCAGCTCCTCGCAGGCAGG + Intergenic
995458151 5:112373652-112373674 TGGCTCTGCCACTTGCTGGCTGG - Intronic
996882191 5:128311987-128312009 TGTCTCAGCCACTTGGACACAGG - Intronic
996971876 5:129379634-129379656 TGGCTCAGTCCGTTCCAGGCTGG - Intergenic
997299578 5:132792744-132792766 ACTCTCAGCACCTTGAAGGCAGG - Intronic
1000450563 5:161381636-161381658 TGTCTCTGCCACTTGGAGGCAGG + Intronic
1002442464 5:179271514-179271536 TCGCTCAGCCCCTTCCACGCTGG + Intronic
1003193259 6:3892580-3892602 TTTCTCAGCCTCTTGCAGCCAGG + Intergenic
1003405373 6:5823451-5823473 TGTATGAACCCCCTGCAGGCAGG + Intergenic
1004185791 6:13420009-13420031 TGTGTGAGCTCCATGCAGGCAGG + Intronic
1004427986 6:15519018-15519040 TGTCTCTGGCCCTTGCAGGCTGG + Intronic
1007386099 6:41521143-41521165 TGGCTCTGCCCCTTGCTGGCAGG + Intergenic
1008247350 6:49194280-49194302 TGTCTCACCCACTTGCAGTTTGG - Intergenic
1009817757 6:68757800-68757822 TGTTTCAGCCCCTTGCAGCCTGG + Intronic
1013418083 6:109942285-109942307 TGTTCCAGCCCATGGCAGGCAGG - Intergenic
1013479220 6:110538720-110538742 TTTCTCAGGCTCTTGCAGCCTGG - Intergenic
1014190177 6:118486995-118487017 TCTCTAAGCTCCTTGAAGGCAGG - Intronic
1015735369 6:136393887-136393909 TGTCTCAGCCCCCTGAGTGCTGG + Intronic
1017042829 6:150321757-150321779 TTTCTCAGCCCCTCCCATGCAGG + Intergenic
1017766050 6:157608330-157608352 TCTCTAAGCTCTTTGCAGGCAGG - Intronic
1019083249 6:169450621-169450643 CGTCTCTGCCCCATCCAGGCAGG + Intergenic
1019295530 7:272112-272134 CGTCTCAGACCCCTGCAGGGAGG + Intergenic
1019625598 7:2014247-2014269 TCTGTCATCCGCTTGCAGGCTGG + Intronic
1020142497 7:5620401-5620423 TGGCACGGCCCCTTGCTGGCTGG + Intronic
1020151653 7:5686367-5686389 TGTCCCAGCCCCCTTCAGGGTGG - Intronic
1021386308 7:20035344-20035366 GTGCTCAGCCCCTTGCAGGAAGG + Intergenic
1022489296 7:30804491-30804513 TGTCTCAGCCTCTTGGGAGCAGG - Intronic
1023480021 7:40624167-40624189 TGTCTCAGCCCCATGTGGACTGG - Intronic
1023519686 7:41038142-41038164 TGTCCCAGCTCCGGGCAGGCAGG - Intergenic
1023879268 7:44309206-44309228 TGTCCCAGCCCCCTGCAGGGAGG - Intronic
1024000338 7:45185311-45185333 TGTCCCAGCCCCTTGTTGGGGGG - Intronic
1024156209 7:46628396-46628418 TGTCTCAGCCCCCCACAGTCTGG - Intergenic
1024522953 7:50323210-50323232 TGTCTCAGCTCCCTGCAGGTTGG - Intronic
1025996069 7:66528276-66528298 TGTCTCAGCCCCTTGCAGGCAGG - Intergenic
1026987711 7:74565110-74565132 TGTCTCAGCCCCTTGCGGGCAGG - Intronic
1029734007 7:102455578-102455600 GGTCTCTGCCCCTGACAGGCTGG - Exonic
1030086977 7:105824356-105824378 TGTCTCAGTCTCTTTCAGGTGGG - Intronic
1030348455 7:108457479-108457501 TGCCCCAGCACCTTGGAGGCTGG - Intergenic
1030744455 7:113148235-113148257 TGTGTCAGCTCTTTGCAGTCTGG + Intergenic
1032203839 7:129844276-129844298 TGTGTTAGCCACTTGCAGGAAGG - Intronic
1033440796 7:141376725-141376747 TGTCTCAGCTTCTAGCAGGTTGG - Intronic
1033713126 7:143969948-143969970 TATATAAGCCCCTTGAAGGCAGG + Intergenic
1034590373 7:152133306-152133328 AATCTCAGCTCCTTGCAGCCTGG + Intergenic
1035812132 8:2501268-2501290 GTGCTCAGCCCCTTGCAGGAAGG - Intergenic
1037056348 8:14445990-14446012 TCACTCAACCCCTTGCAGGAGGG - Intronic
1037500944 8:19485013-19485035 TTTCTCACCCACTGGCAGGCTGG - Intronic
1038248955 8:25884645-25884667 TGTGCCAGCCCATGGCAGGCAGG + Intronic
1039265111 8:35815784-35815806 TGTCTGAGCTCCTTGCGGGAGGG + Intergenic
1040530379 8:48261668-48261690 TGTCACAGAGCCTTGCAGTCAGG + Intergenic
1040564673 8:48555062-48555084 TATCTCAGCAGCATGCAGGCCGG - Intergenic
1040874070 8:52131988-52132010 TGGCCCAGCCCATTGCAGCCTGG + Exonic
1043548681 8:81344125-81344147 TGTCTCACCCTCCTGCAGGAAGG - Intergenic
1043917484 8:85939436-85939458 TGATTCAGCCCCTTCAAGGCTGG + Intergenic
1044531261 8:93310188-93310210 TGTCTCAGGCACTTACAGACTGG - Intergenic
1045111162 8:98940480-98940502 TGACTCAGTGCCTCGCAGGCTGG + Intronic
1047268459 8:123331035-123331057 TGCCTCAGTCCCTTGAGGGCTGG + Intronic
1047923897 8:129663683-129663705 GATCTCAGCCCATTGCAGCCTGG - Intergenic
1049058006 8:140254287-140254309 TATTTCAGTCCCTTCCAGGCTGG - Intronic
1049498368 8:142947326-142947348 TGTGTCAGCCCATGGCAGGCTGG - Intergenic
1049615290 8:143573204-143573226 TGGCTCCGCCCCCTGCACGCTGG + Intergenic
1049826578 8:144672635-144672657 TGAACCAGCCTCTTGCAGGCTGG - Intergenic
1057008171 9:91578878-91578900 TCTCCCAGCCCCTTGCTTGCTGG - Intronic
1057146252 9:92761177-92761199 TGTCTCAGGCCCCTACAGCCTGG - Intronic
1057909092 9:99004362-99004384 TTTCTCAGCCCCTTGCTCACTGG - Intronic
1058539690 9:105998879-105998901 TGTACCAGCTCCTTGCAGGCTGG + Intergenic
1058588182 9:106532679-106532701 GCACTCAGCCCCTTGCAGGAGGG + Intergenic
1059458662 9:114415698-114415720 AGGCTCAGCCCCTGGCAGGCAGG + Intronic
1059632883 9:116143363-116143385 TGTTTCACCCCTTTGCAGGGAGG + Intergenic
1059685919 9:116635891-116635913 TTTCTCAGCCCCTTGGAAACTGG - Intronic
1060530552 9:124344989-124345011 TGTCTGAGGCCCTGACAGGCAGG + Intronic
1060554333 9:124500513-124500535 GGGCTCAGGCCCATGCAGGCTGG + Exonic
1060836468 9:126758748-126758770 TGTCTCTGTCCCTGGCAGGATGG - Intergenic
1061002215 9:127908761-127908783 TGGCTCTGCCTCTTGCAAGCTGG + Intronic
1061012053 9:127961562-127961584 AGTATAAGCCCCTTGAAGGCAGG - Intronic
1061409352 9:130410464-130410486 AGCCTAAGCCCCTTGCTGGCTGG + Intronic
1062071884 9:134560171-134560193 TGCCTCATGCCCTTGGAGGCTGG + Intergenic
1062735849 9:138137078-138137100 CAGCCCAGCCCCTTGCAGGCTGG + Intergenic
1203437597 Un_GL000195v1:155539-155561 TGTCTCAGCCAATAGCATGCAGG - Intergenic
1186460224 X:9742563-9742585 TGAATCAGTACCTTGCAGGCAGG - Intronic
1186664513 X:11704091-11704113 TGGCCCAGCCCCCTGCAGGGGGG - Intergenic
1187676770 X:21723978-21724000 TGTCAGAGCCCCTGGCTGGCAGG - Intronic
1188893959 X:35643664-35643686 ATGCTCAGCCCCTTGCAGGAGGG - Intergenic
1189604978 X:42667472-42667494 ACTCTAAGCCCCTTGAAGGCAGG - Intergenic
1192139732 X:68637471-68637493 TGGCTCAGCCCCTTGGGGCCTGG + Intergenic
1194119191 X:89939063-89939085 TGTCTGTGTCCCTTCCAGGCTGG + Intergenic
1198071334 X:133151471-133151493 GGTCACAGCCACTGGCAGGCTGG + Intergenic
1200177567 X:154127599-154127621 TGCCTCAGCCTCTGGGAGGCAGG - Intergenic
1200472065 Y:3596622-3596644 TGTCTGTGTCCCTTCCAGGCTGG + Intergenic
1200523868 Y:4247441-4247463 TGACTGAGCTCCTTGCAGGAGGG + Intergenic
1202266716 Y:23027631-23027653 CCTCTGAGGCCCTTGCAGGCAGG - Intergenic
1202419709 Y:24661376-24661398 CCTCTGAGGCCCTTGCAGGCAGG - Intergenic
1202451077 Y:25008708-25008730 CCTCTGAGGCCCTTGCAGGCAGG + Intergenic