ID: 1025996070

View in Genome Browser
Species Human (GRCh38)
Location 7:66528280-66528302
Sequence GGGTTGTCTCAGCCCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996070_1025996072 -6 Left 1025996070 7:66528280-66528302 CCTGCAAGGGGCTGAGACAACCC No data
Right 1025996072 7:66528297-66528319 CAACCCACGCTCGACCCTGAGGG 0: 1
1: 1
2: 0
3: 2
4: 46
1025996070_1025996076 8 Left 1025996070 7:66528280-66528302 CCTGCAAGGGGCTGAGACAACCC No data
Right 1025996076 7:66528311-66528333 CCCTGAGGGCTGAACACCATTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1025996070_1025996071 -7 Left 1025996070 7:66528280-66528302 CCTGCAAGGGGCTGAGACAACCC No data
Right 1025996071 7:66528296-66528318 ACAACCCACGCTCGACCCTGAGG No data
1025996070_1025996078 15 Left 1025996070 7:66528280-66528302 CCTGCAAGGGGCTGAGACAACCC No data
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996070 Original CRISPR GGGTTGTCTCAGCCCCTTGC AGG (reversed) Intergenic
No off target data available for this crispr