ID: 1025996073 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:66528300-66528322 |
| Sequence | CAGCCCTCAGGGTCGAGCGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 94 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 3, 4: 89} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1025996073_1025996080 | 18 | Left | 1025996073 | 7:66528300-66528322 | CCCACGCTCGACCCTGAGGGCTG | 0: 1 1: 1 2: 0 3: 3 4: 89 |
||
| Right | 1025996080 | 7:66528341-66528363 | TAGCTCTATACTGCCCAACCAGG | No data | ||||
| 1025996073_1025996078 | -5 | Left | 1025996073 | 7:66528300-66528322 | CCCACGCTCGACCCTGAGGGCTG | 0: 1 1: 1 2: 0 3: 3 4: 89 |
||
| Right | 1025996078 | 7:66528318-66528340 | GGCTGAACACCATTGGTAGCTGG | 0: 1 1: 1 2: 2 3: 3 4: 69 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1025996073 | Original CRISPR | CAGCCCTCAGGGTCGAGCGT GGG (reversed) | Intergenic | ||