ID: 1025996073

View in Genome Browser
Species Human (GRCh38)
Location 7:66528300-66528322
Sequence CAGCCCTCAGGGTCGAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996073_1025996078 -5 Left 1025996073 7:66528300-66528322 CCCACGCTCGACCCTGAGGGCTG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996073_1025996080 18 Left 1025996073 7:66528300-66528322 CCCACGCTCGACCCTGAGGGCTG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1025996080 7:66528341-66528363 TAGCTCTATACTGCCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996073 Original CRISPR CAGCCCTCAGGGTCGAGCGT GGG (reversed) Intergenic
900292532 1:1929604-1929626 CAGCCCTCAGGGTCACCCGAAGG + Intronic
901455463 1:9360572-9360594 CAGCCCCCAGGGGCGAGGGGAGG - Intronic
902556121 1:17247831-17247853 GAGGCCTCAGGGGCCAGCGTTGG - Intergenic
903283669 1:22264265-22264287 TGGCCCTCAGGGTCGAGAGAGGG - Intergenic
907233235 1:53020775-53020797 CAGCCCACAGAGTTGAGAGTTGG - Intronic
908739079 1:67308337-67308359 CACCCCTGAGGGTCCAGCCTTGG + Intronic
913616984 1:120570330-120570352 CAGCTCTCAGGGTGGTGCATGGG + Intergenic
914450600 1:147788130-147788152 CAGGCCTGAGGGTAGAGCCTGGG - Intergenic
914573291 1:148940585-148940607 CAGCTCTCAGGGTGGTGCATGGG - Intronic
922573940 1:226650136-226650158 CAGCCCTCAGGGGTCAGCGGCGG + Intronic
1069271047 10:66528099-66528121 CAGCCCTTATGAGCGAGCGTGGG - Intronic
1071195360 10:83153289-83153311 CAGGCCTGAGGGTGGAGCCTTGG - Intergenic
1073453141 10:103621358-103621380 CAGCCCACAGGGTCCAGCCCAGG + Intronic
1073595094 10:104791657-104791679 TAGCCCTCAGCTTGGAGCGTGGG + Intronic
1074819357 10:117167075-117167097 CAGCCCTGAGGGCTGAGTGTTGG + Intergenic
1075903679 10:126063182-126063204 CAGCACTCAGGGATGCGCGTGGG - Intronic
1077919504 11:6632138-6632160 CAGCCCCCAGGGACCAGCGTGGG - Exonic
1083572918 11:63769448-63769470 CAGCCCGCAGGGTCGGGCCCCGG - Intergenic
1088522252 11:110712404-110712426 CAGCCCGCGGTGTCGAGCGCAGG - Exonic
1102535054 12:113575252-113575274 CAGAACTCAGGGTCCAGGGTGGG + Intergenic
1103621754 12:122191259-122191281 CAGCACTCAGGGCTGAGCCTTGG - Intronic
1106255639 13:28019879-28019901 CAGCCCTCAGGAGTGAGAGTAGG - Intronic
1109025268 13:57146824-57146846 CAGCCCTCGGGGTTGGGCGCAGG - Intronic
1109026258 13:57153397-57153419 CAGCCCTCGGGGTTGGGCGCAGG - Intronic
1109027250 13:57159968-57159990 CAGCCCTCGGGGTTGGGCGCAGG - Intergenic
1109028236 13:57166533-57166555 CAGCCCTCGGGGTTGGGCGCAGG - Intergenic
1109029223 13:57173104-57173126 CAGCCCTCGGGGTTGGGCGCAGG - Intergenic
1113782740 13:112986021-112986043 GAGCCCCCAGGGCCGTGCGTGGG + Intronic
1118772626 14:68952312-68952334 CAGCCCGCAGGGTCCCGGGTGGG - Intronic
1118969586 14:70622115-70622137 CATCCCTGAGGGTGGAGCCTTGG - Intergenic
1119623722 14:76152276-76152298 CAGCCCTCAGGGACGGGCCGGGG + Intronic
1122111848 14:99508783-99508805 CAGGCTACAGGGTCGAGTGTTGG + Exonic
1122999676 14:105286567-105286589 CAGCCAGCAGGGTTGAGGGTGGG + Intronic
1124200730 15:27676852-27676874 CAGGCCTCAGTGTCCAGGGTTGG - Intergenic
1124631186 15:31338598-31338620 CAGCCTTCAGGATGGAGGGTGGG + Intronic
1125508543 15:40281147-40281169 CAGCCCTCAGGCTCAATCCTGGG - Intronic
1126136965 15:45402233-45402255 CGGGCCTCTGGGTAGAGCGTTGG - Intronic
1130023741 15:80252293-80252315 CAGCCCCCGGGGCAGAGCGTTGG + Intergenic
1132321112 15:100926365-100926387 CAGCCCTGAGGGACGAGGGTGGG + Intronic
1132734220 16:1377639-1377661 CAGCCCTCAGGGAGGAGGGTGGG - Intronic
1134446278 16:14333640-14333662 CAGCCCACAGGGGCGGGGGTGGG + Intergenic
1136416090 16:30104711-30104733 CAGCCCTGAGGCTGGAGCCTGGG - Intergenic
1136502634 16:30680516-30680538 CTGCCCTCAGGGTGTAGGGTGGG - Intergenic
1142241925 16:88951293-88951315 CAGCACAGAGGGTCGAGTGTTGG + Exonic
1142692823 17:1617135-1617157 CAGACCTCAGGGCCCAGCCTTGG + Intronic
1144728265 17:17512491-17512513 CAGCCCTCAGGGTCTTACCTAGG + Exonic
1146653824 17:34623477-34623499 CAGCCCAGAGGGAGGAGCGTGGG + Intronic
1168521732 19:57056515-57056537 CAGACCTGAGGGTGGAGGGTGGG + Intergenic
929501335 2:42493793-42493815 CAGCCCTCGGGCGCGAGGGTCGG - Exonic
932703541 2:74006502-74006524 CTGCCCTCAGGGACCACCGTGGG + Intronic
938133878 2:128737928-128737950 CAGCCCTAAGGGACGAGTTTTGG - Intergenic
942051877 2:172147631-172147653 CAGCCCTCAGAGTGGAGAGATGG + Intergenic
949078738 2:242079498-242079520 CAGCCCTCCCGGTGGAGCGGAGG + Intergenic
1169216691 20:3798247-3798269 CAGCTCTCAGGGTCCATGGTTGG + Intronic
1176191259 20:63811192-63811214 CAGCCCACAGGGGCGAGTCTGGG + Intronic
1180073512 21:45450332-45450354 CAGCCTTCAGGGTCGAGGTGTGG + Intronic
1181349195 22:22243378-22243400 CAGCCCGCAGGGTCGACTCTGGG - Intergenic
1181776744 22:25165714-25165736 CAGCCCTCAGGGTAGGACGGTGG + Intronic
1183655229 22:39180610-39180632 CAGCCATCAGGGACAAGGGTGGG - Intergenic
1184978310 22:48078812-48078834 CAGCACACAGGGCCGAGCCTGGG - Intergenic
950565631 3:13768136-13768158 CAGACCTCAGGGTGGACCCTTGG + Intergenic
954038763 3:47868496-47868518 CAGCCCTTAGGGACCAGCATGGG - Intronic
954634093 3:52062282-52062304 CAGCCTGCAGGGTCTAGGGTGGG + Intergenic
957827229 3:85463635-85463657 CAGCCTTCAGGGTTGAACATGGG - Intronic
961392052 3:126558032-126558054 CACTCCTCAGGGTTGAGCCTGGG - Intronic
961459173 3:127039377-127039399 CAGCCCTGATGGTGGAGCTTTGG + Intergenic
968868765 4:3230387-3230409 CAGGCCTCAGGGCAGAGCATGGG - Intronic
968909529 4:3470502-3470524 GAGGTCTGAGGGTCGAGCGTGGG + Intronic
980383928 4:132062582-132062604 CAGCACTCTGGGTCTAGCCTGGG - Intergenic
985760484 5:1746314-1746336 CAGCCCTCAGGGTCCTGCCAGGG - Intergenic
994321421 5:98399212-98399234 CATCCCTCAGAGTCAAGCCTAGG - Intergenic
996679947 5:126220953-126220975 CAGCACTCAGAGGCCAGCGTGGG + Intergenic
999354414 5:150911274-150911296 CAGACCTCAGGGTGGTGCTTGGG - Intergenic
1001273115 5:170330799-170330821 GTGCCCTCAGGATCCAGCGTGGG + Intergenic
1007373760 6:41443058-41443080 GAGCCCTCAGGGTCTAGCCCCGG - Intergenic
1017797933 6:157864629-157864651 GAGCCCTCAGAGTGGAGCCTGGG - Intronic
1018666496 6:166143273-166143295 CAGCTCTCAGGGTGGAAGGTGGG - Intergenic
1022090812 7:27106897-27106919 CAGCCCTCTGGCTCCAGCATGGG - Exonic
1025996073 7:66528300-66528322 CAGCCCTCAGGGTCGAGCGTGGG - Intergenic
1026212048 7:68314392-68314414 CTGCCCTGAGGGTAGAGCCTGGG + Intergenic
1026540239 7:71274052-71274074 CAGCCCTCTGGGTAGGGCGAGGG + Intronic
1026987718 7:74565134-74565156 CAGCCCCCAGGGTCGAGCGTGGG - Intronic
1027985776 7:85287410-85287432 CAGTCCCCAGGGACGAGCTTAGG - Intergenic
1035344724 7:158190630-158190652 CACCCCTCATGGTGGAGGGTGGG - Intronic
1035537004 8:399519-399541 CAGCCCTCCCGGTGGAGCGGAGG + Intergenic
1042514507 8:69645157-69645179 CAGCTCTCATGGCCGAGCTTTGG - Intronic
1044441739 8:92231306-92231328 CAGCACTCAGTGTCTAGCTTGGG + Intergenic
1045007503 8:97929073-97929095 CAGCCCTCAGGGTTATGCATGGG + Intronic
1056361613 9:85863267-85863289 CAGCCCTCAGAGTCTAGTGGAGG - Intergenic
1057262540 9:93593223-93593245 CAGCCCTCAGGGGTCAGCTTTGG - Intronic
1058879147 9:109271615-109271637 CAGTCCTCAAAGCCGAGCGTAGG - Intronic
1059416925 9:114168120-114168142 GAGCCCCCAGGGTCGAGTGCAGG - Exonic
1060246292 9:121949272-121949294 CAGCCCTGAAGCTTGAGCGTGGG - Intronic
1061324988 9:129858301-129858323 CAGCCCTCAGGGTCCTGACTGGG + Intronic