ID: 1025996074 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:66528301-66528323 |
Sequence | TCAGCCCTCAGGGTCGAGCG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 107 | |||
Summary | {0: 1, 1: 1, 2: 2, 3: 2, 4: 101} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1025996074_1025996080 | 17 | Left | 1025996074 | 7:66528301-66528323 | CCACGCTCGACCCTGAGGGCTGA | 0: 1 1: 1 2: 2 3: 2 4: 101 |
||
Right | 1025996080 | 7:66528341-66528363 | TAGCTCTATACTGCCCAACCAGG | No data | ||||
1025996074_1025996078 | -6 | Left | 1025996074 | 7:66528301-66528323 | CCACGCTCGACCCTGAGGGCTGA | 0: 1 1: 1 2: 2 3: 2 4: 101 |
||
Right | 1025996078 | 7:66528318-66528340 | GGCTGAACACCATTGGTAGCTGG | 0: 1 1: 1 2: 2 3: 3 4: 69 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1025996074 | Original CRISPR | TCAGCCCTCAGGGTCGAGCG TGG (reversed) | Intergenic | ||