ID: 1025996074

View in Genome Browser
Species Human (GRCh38)
Location 7:66528301-66528323
Sequence TCAGCCCTCAGGGTCGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 2, 3: 2, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996074_1025996078 -6 Left 1025996074 7:66528301-66528323 CCACGCTCGACCCTGAGGGCTGA 0: 1
1: 1
2: 2
3: 2
4: 101
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996074_1025996080 17 Left 1025996074 7:66528301-66528323 CCACGCTCGACCCTGAGGGCTGA 0: 1
1: 1
2: 2
3: 2
4: 101
Right 1025996080 7:66528341-66528363 TAGCTCTATACTGCCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996074 Original CRISPR TCAGCCCTCAGGGTCGAGCG TGG (reversed) Intergenic