ID: 1025996078

View in Genome Browser
Species Human (GRCh38)
Location 7:66528318-66528340
Sequence GGCTGAACACCATTGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996070_1025996078 15 Left 1025996070 7:66528280-66528302 CCTGCAAGGGGCTGAGACAACCC No data
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996067_1025996078 24 Left 1025996067 7:66528271-66528293 CCAGCCCTGCCTGCAAGGGGCTG 0: 1
1: 1
2: 1
3: 70
4: 527
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996068_1025996078 20 Left 1025996068 7:66528275-66528297 CCCTGCCTGCAAGGGGCTGAGAC 0: 1
1: 1
2: 2
3: 23
4: 306
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996074_1025996078 -6 Left 1025996074 7:66528301-66528323 CCACGCTCGACCCTGAGGGCTGA 0: 1
1: 1
2: 2
3: 2
4: 101
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996073_1025996078 -5 Left 1025996073 7:66528300-66528322 CCCACGCTCGACCCTGAGGGCTG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996069_1025996078 19 Left 1025996069 7:66528276-66528298 CCTGCCTGCAAGGGGCTGAGACA 0: 1
1: 1
2: 3
3: 30
4: 304
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996078 Original CRISPR GGCTGAACACCATTGGTAGC TGG Intergenic
910675232 1:89809550-89809572 GACTGAACACCATGGTTAGCTGG + Intronic
912496225 1:110093857-110093879 GGTTGACCACCAGTGGTAGATGG + Intergenic
914342658 1:146773613-146773635 TGCTGAAGGCCATTGGCAGCCGG + Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1068071981 10:52207086-52207108 GACTGCACATCATTGGGAGCAGG + Intronic
1069753153 10:70757731-70757753 GGCTCTTCACCATTGGTATCAGG + Intronic
1071949106 10:90682738-90682760 TGCTTAACACCACTGGAAGCAGG + Intergenic
1075741955 10:124701455-124701477 GGCTGAAGACCAAAGGGAGCTGG - Intronic
1079158127 11:17967832-17967854 GGCTGACCAGCATTGTGAGCTGG - Intronic
1079324570 11:19480539-19480561 TGCTGAACACCATTGTAAACAGG - Intronic
1079852310 11:25551169-25551191 TGTTGGACACCATTGGAAGCTGG + Intergenic
1085146826 11:74207820-74207842 AGCTGAAAACCATTGGAGGCTGG - Intronic
1095049260 12:37542283-37542305 GGGTGAAAACCATTGACAGCCGG - Intergenic
1098013623 12:66081037-66081059 GGCACAACATCTTTGGTAGCAGG + Intergenic
1101737827 12:107476165-107476187 GGCTGAACAGCCTAGGTAGCCGG - Intronic
1106468397 13:30033339-30033361 GGCTGAACCCAACTGGTAGGGGG - Intergenic
1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG + Intergenic
1132210367 15:100017429-100017451 GGCTGAACACCACAGGGAGAAGG - Intronic
1138195151 16:55046460-55046482 GGCTGGACACAATTGAAAGCTGG - Intergenic
1139991326 16:70941715-70941737 TGCTGAAGGCCATTGGCAGCCGG - Exonic
1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1156460053 18:37316546-37316568 GGCTTGTCACCATTGGAAGCAGG - Intronic
1157444301 18:47733275-47733297 AGCTGGACACCTTTGGGAGCTGG - Intergenic
927516909 2:23677184-23677206 GGCTGCACACCAGTGGGTGCGGG - Intronic
935376763 2:102408085-102408107 GGCTGGAAACCAATGGTACCTGG + Intergenic
943301865 2:186212653-186212675 GACTCAACACCATTGCTTGCAGG + Intergenic
1168845062 20:938841-938863 GGCTGCACAGCCTTTGTAGCAGG - Intergenic
955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG + Intronic
956777882 3:72580693-72580715 GGCTGATCTCCATGGGCAGCTGG - Intergenic
957251176 3:77772820-77772842 GTATGAATACCATTGGGAGCTGG - Intergenic
960881913 3:122353978-122354000 GGAAGAACACCAGTGGAAGCTGG - Intergenic
962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG + Intronic
964336494 3:155660180-155660202 GGCTGAACACAATTGAAAGTCGG + Intronic
965906168 3:173709232-173709254 GGCTGAACTCCAGTGTTAGAAGG - Intronic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
974867903 4:67603183-67603205 GAGTGAACATCAGTGGTAGCCGG - Intronic
980874511 4:138647672-138647694 GGCTGAACACCACTGGGAGGTGG - Intergenic
980875320 4:138656395-138656417 GGGTGATCACCTTTGGTACCAGG + Intergenic
984334867 4:178378032-178378054 GGATGAACACCCTTGGAACCTGG - Intergenic
984642053 4:182177433-182177455 GGCTGAAGACCAAGGGCAGCGGG - Intronic
987340915 5:16937847-16937869 ATCTGAACACCAGTGGTTGCAGG - Intergenic
989005408 5:36805188-36805210 TGCTCAACATCATTGGTAACTGG - Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
995823025 5:116259576-116259598 GGCTGAACAGTCTTGGTGGCTGG + Intronic
999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG + Intronic
1002044180 5:176532849-176532871 GGCTGAACACCATTGGTCCCTGG - Intronic
1005710592 6:28500464-28500486 TTCTTAACACCACTGGTAGCTGG + Intergenic
1006750075 6:36371569-36371591 AGATGAGCACCAGTGGTAGCAGG + Intronic
1014612943 6:123567358-123567380 GCCAGCATACCATTGGTAGCTGG - Intronic
1019296247 7:276833-276855 GGCTGCACACCCCAGGTAGCTGG - Intergenic
1020643798 7:10788965-10788987 TGCTGTACACCATTGGTGGTGGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1037179807 8:15992221-15992243 AGATGGACACCAGTGGTAGCAGG + Intergenic
1037209145 8:16363859-16363881 GGAGGAAGACCATTGCTAGCTGG + Intronic
1042740959 8:72045925-72045947 GAATGAACCCCATTGGAAGCAGG - Intronic
1044434091 8:92141723-92141745 GGTTGTAAACCAGTGGTAGCTGG + Intergenic
1045892631 8:107175176-107175198 GGCTGTACTCCAGGGGTAGCAGG + Intergenic
1049349255 8:142155199-142155221 GCCTGCACACCGTTGGTAGTTGG + Intergenic
1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG + Intronic
1055786492 9:79874527-79874549 GGCTGAACTCCAGAGGTGGCAGG + Intergenic