ID: 1025996078

View in Genome Browser
Species Human (GRCh38)
Location 7:66528318-66528340
Sequence GGCTGAACACCATTGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025996074_1025996078 -6 Left 1025996074 7:66528301-66528323 CCACGCTCGACCCTGAGGGCTGA 0: 1
1: 1
2: 2
3: 2
4: 101
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996073_1025996078 -5 Left 1025996073 7:66528300-66528322 CCCACGCTCGACCCTGAGGGCTG 0: 1
1: 1
2: 0
3: 3
4: 89
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996070_1025996078 15 Left 1025996070 7:66528280-66528302 CCTGCAAGGGGCTGAGACAACCC No data
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996068_1025996078 20 Left 1025996068 7:66528275-66528297 CCCTGCCTGCAAGGGGCTGAGAC 0: 1
1: 1
2: 2
3: 23
4: 306
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996069_1025996078 19 Left 1025996069 7:66528276-66528298 CCTGCCTGCAAGGGGCTGAGACA 0: 1
1: 1
2: 3
3: 30
4: 304
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69
1025996067_1025996078 24 Left 1025996067 7:66528271-66528293 CCAGCCCTGCCTGCAAGGGGCTG 0: 1
1: 1
2: 1
3: 70
4: 527
Right 1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG 0: 1
1: 1
2: 2
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025996078 Original CRISPR GGCTGAACACCATTGGTAGC TGG Intergenic