ID: 1025997324

View in Genome Browser
Species Human (GRCh38)
Location 7:66536254-66536276
Sequence CAGTGACGCCTTTGGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997324_1025997338 18 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997338 7:66536295-66536317 GAGGTCACTGCTGCAGGGATGGG No data
1025997324_1025997337 17 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997337 7:66536294-66536316 GGAGGTCACTGCTGCAGGGATGG No data
1025997324_1025997336 13 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997336 7:66536290-66536312 GGCAGGAGGTCACTGCTGCAGGG No data
1025997324_1025997335 12 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997335 7:66536289-66536311 GGGCAGGAGGTCACTGCTGCAGG No data
1025997324_1025997333 -1 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997333 7:66536276-66536298 GTCCAGGGGCAGTGGGCAGGAGG No data
1025997324_1025997330 -9 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997330 7:66536268-66536290 GCGTCACTGTCCAGGGGCAGTGG No data
1025997324_1025997332 -4 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997332 7:66536273-66536295 ACTGTCCAGGGGCAGTGGGCAGG No data
1025997324_1025997331 -8 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997331 7:66536269-66536291 CGTCACTGTCCAGGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997324 Original CRISPR CAGTGACGCCTTTGGTGGAC AGG (reversed) Intergenic
No off target data available for this crispr