ID: 1025997325

View in Genome Browser
Species Human (GRCh38)
Location 7:66536259-66536281
Sequence CTGGACAGTGACGCCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997325_1025997338 13 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997338 7:66536295-66536317 GAGGTCACTGCTGCAGGGATGGG No data
1025997325_1025997333 -6 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997333 7:66536276-66536298 GTCCAGGGGCAGTGGGCAGGAGG No data
1025997325_1025997337 12 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997337 7:66536294-66536316 GGAGGTCACTGCTGCAGGGATGG No data
1025997325_1025997336 8 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997336 7:66536290-66536312 GGCAGGAGGTCACTGCTGCAGGG No data
1025997325_1025997339 26 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997339 7:66536308-66536330 CAGGGATGGGTTCTTTCAGCAGG No data
1025997325_1025997332 -9 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997332 7:66536273-66536295 ACTGTCCAGGGGCAGTGGGCAGG No data
1025997325_1025997335 7 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997335 7:66536289-66536311 GGGCAGGAGGTCACTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997325 Original CRISPR CTGGACAGTGACGCCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr