ID: 1025997328

View in Genome Browser
Species Human (GRCh38)
Location 7:66536262-66536284
Sequence CCCCTGGACAGTGACGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997328_1025997333 -9 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997333 7:66536276-66536298 GTCCAGGGGCAGTGGGCAGGAGG No data
1025997328_1025997338 10 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997338 7:66536295-66536317 GAGGTCACTGCTGCAGGGATGGG No data
1025997328_1025997336 5 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997336 7:66536290-66536312 GGCAGGAGGTCACTGCTGCAGGG No data
1025997328_1025997335 4 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997335 7:66536289-66536311 GGGCAGGAGGTCACTGCTGCAGG No data
1025997328_1025997337 9 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997337 7:66536294-66536316 GGAGGTCACTGCTGCAGGGATGG No data
1025997328_1025997339 23 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997339 7:66536308-66536330 CAGGGATGGGTTCTTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997328 Original CRISPR CCCCTGGACAGTGACGCCTT TGG (reversed) Intergenic