ID: 1025997332

View in Genome Browser
Species Human (GRCh38)
Location 7:66536273-66536295
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997324_1025997332 -4 Left 1025997324 7:66536254-66536276 CCTGTCCACCAAAGGCGTCACTG No data
Right 1025997332 7:66536273-66536295 ACTGTCCAGGGGCAGTGGGCAGG No data
1025997325_1025997332 -9 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997332 7:66536273-66536295 ACTGTCCAGGGGCAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997332 Original CRISPR ACTGTCCAGGGGCAGTGGGC AGG Intergenic
No off target data available for this crispr