ID: 1025997334

View in Genome Browser
Species Human (GRCh38)
Location 7:66536278-66536300
Sequence GACCTCCTGCCCACTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 2, 1: 0, 2: 4, 3: 52, 4: 452}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997334_1025997339 7 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997339 7:66536308-66536330 CAGGGATGGGTTCTTTCAGCAGG No data
1025997334_1025997338 -6 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997338 7:66536295-66536317 GAGGTCACTGCTGCAGGGATGGG No data
1025997334_1025997341 28 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997341 7:66536329-66536351 GGACTTTCTGCACAGCACTAGGG No data
1025997334_1025997340 27 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997340 7:66536328-66536350 AGGACTTTCTGCACAGCACTAGG No data
1025997334_1025997337 -7 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997337 7:66536294-66536316 GGAGGTCACTGCTGCAGGGATGG No data
1025997334_1025997342 29 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997342 7:66536330-66536352 GACTTTCTGCACAGCACTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997334 Original CRISPR GACCTCCTGCCCACTGCCCC TGG (reversed) Intergenic
900114121 1:1021260-1021282 GACTTCCTCCCCGCTGCTCCTGG + Intronic
900179713 1:1305823-1305845 GGCCTCCGGCCCACTGCACCTGG + Intronic
900310091 1:2029378-2029400 GCCCGGCTGGCCACTGCCCCAGG - Intronic
900423239 1:2564721-2564743 GCCCTTCTGCCCACAGTCCCGGG + Intronic
900554532 1:3273129-3273151 CTCCTGCTCCCCACTGCCCCTGG - Intronic
900666816 1:3821072-3821094 GGCCTCATGCCCACTGCTGCTGG - Intronic
900979939 1:6040648-6040670 GACCCCCTGCCCCCTCACCCAGG + Intronic
901058318 1:6459977-6459999 GCCCCCCTCCCCACTGCCTCAGG + Exonic
901228966 1:7631351-7631373 CACCTCCAGACCACTGCCCCAGG - Intronic
901503922 1:9672017-9672039 CATCTCCTACCCACTCCCCCTGG - Intronic
902120396 1:14160093-14160115 GACCTTCTGTCCACTGTCTCTGG + Intergenic
902187008 1:14733172-14733194 GACTTTCCGCCCACTGCCCCAGG + Intronic
902516129 1:16990484-16990506 GAGCTCCAGCCCACGGCTCCAGG - Intronic
902585306 1:17435528-17435550 GGCCTCCTGCCCAGTCTCCCTGG - Intronic
902616467 1:17626111-17626133 GACCTCCTCCCTCCTACCCCAGG - Intronic
902715940 1:18272715-18272737 GGCCCCCTCTCCACTGCCCCAGG - Intronic
903232349 1:21929678-21929700 CACCTCCTGCCCACTCCTCCTGG + Intronic
903288492 1:22292058-22292080 GACCTCCACCCCACGGCCCGAGG + Intergenic
903365936 1:22805483-22805505 GACCTCCCTCCCACTGCCTGAGG + Intronic
903833687 1:26189532-26189554 GACCTCCTGACCTCTGACCCTGG + Exonic
904319477 1:29687145-29687167 GACCCACTGCCCCCAGCCCCTGG - Intergenic
904782808 1:32963861-32963883 GACACCCCGCCCCCTGCCCCAGG - Intronic
905930295 1:41782295-41782317 TCCCTTCTGCCCACAGCCCCTGG - Intronic
906117880 1:43367778-43367800 GACCTCCCACCCACTGGCCCCGG + Intronic
907337944 1:53712722-53712744 GCCCTCCTCCCGAGTGCCCCAGG + Intronic
908292682 1:62684131-62684153 AACCTCCACCCCACTGCCCCGGG - Intronic
908755896 1:67468450-67468472 CACAGCCTGCCCACTGCCCCAGG - Intergenic
908903784 1:68985274-68985296 GACCTCCTTCCCACAGCCAAGGG + Intergenic
910323965 1:85982252-85982274 GCCCTCCTCCCCACAGCCCCTGG - Intronic
911864887 1:103006057-103006079 GAGCTCCTGACCTTTGCCCCAGG + Exonic
914681845 1:149944234-149944256 GACCCCCTGCCAACTGCCTCCGG + Exonic
915102173 1:153508332-153508354 GGCCTCCCGGCCCCTGCCCCTGG - Intergenic
915196150 1:154191442-154191464 CACTTCCAGCCCACTGCCTCAGG + Intronic
915324147 1:155071915-155071937 GACCTCATGCCCCAGGCCCCGGG - Intergenic
915367268 1:155323358-155323380 GCCCTCCTTCCCTCTGCGCCTGG + Intronic
915558057 1:156670866-156670888 GCCCTCCCACCCCCTGCCCCGGG + Exonic
915594932 1:156891467-156891489 TTCCTCCTGCCCCCAGCCCCTGG - Intergenic
915931245 1:160062186-160062208 CACCTCCTGCCCATCCCCCCTGG + Intronic
916063650 1:161119158-161119180 TTCCTCCTGCGAACTGCCCCTGG + Exonic
916482848 1:165230914-165230936 GAACTCTTGCCCACTGCCCAGGG + Intronic
917473096 1:175342765-175342787 GACCACCTGCCTTCTGCCCAAGG + Intronic
918048542 1:180955409-180955431 GGCCTCTTCCCCACTACCCCAGG - Intergenic
919758947 1:201084925-201084947 GAGTATCTGCCCACTGCCCCAGG - Intronic
919777953 1:201206338-201206360 GCCCTCCTGTCCAGGGCCCCAGG - Exonic
919818847 1:201459974-201459996 GCCACCCTACCCACTGCCCCAGG - Intergenic
919883749 1:201917845-201917867 GGCCTCCTGCTCACAGCCCCAGG - Intronic
920049297 1:203153684-203153706 GACATCCTGCCCCCTCCCCAGGG + Intronic
920848377 1:209612008-209612030 GGCCGCCGGCCCACTGCCCCTGG + Exonic
920942424 1:210496252-210496274 GGCCTCCTGCCAACAGCCACAGG - Intronic
921238826 1:213155279-213155301 GTCCTCCTGTCCACTGTCTCTGG + Intronic
922608696 1:226908268-226908290 GACCTTCAGCCGACTGTCCCAGG + Intronic
922729063 1:227940649-227940671 GACCTCCAGCCCACTTCCCCTGG + Intronic
922756525 1:228100077-228100099 GACACCCAGCCCACTGCCTCTGG + Intergenic
923107192 1:230863786-230863808 CAACTCCTGCCCAGGGCCCCAGG + Intronic
1062805425 10:416214-416236 CTCCTCATTCCCACTGCCCCAGG + Intronic
1063582077 10:7317123-7317145 GTCCTCGTGCCCCCTCCCCCAGG + Intronic
1067030826 10:42878117-42878139 GCCCTCCTGCCCACCCACCCCGG + Intergenic
1067734684 10:48840315-48840337 GAGCCCCTCCCCACCGCCCCAGG - Intronic
1067964105 10:50889454-50889476 GACTTCCTTCCCATTGGCCCTGG - Intergenic
1068164620 10:53312744-53312766 GACTTCCTTCCCACAGCCTCAGG - Intergenic
1068935112 10:62628167-62628189 GGCCTCCTGGCCTCTGCTCCTGG + Intronic
1069756101 10:70775264-70775286 GGCCTCCTGCCCACAGGTCCTGG - Exonic
1069834494 10:71300292-71300314 GCCCTCCCTCCCACAGCCCCAGG + Exonic
1069884700 10:71616286-71616308 GGCCTCCTTCCCAGAGCCCCTGG - Intronic
1070318998 10:75340156-75340178 GACCCCCCGCCCCCTCCCCCCGG - Intergenic
1072634007 10:97165728-97165750 GCCCTCCTGCTCACTGCTGCAGG - Intronic
1072712911 10:97729280-97729302 TTCCTCCTCCCCACAGCCCCTGG + Intergenic
1073059366 10:100724311-100724333 TCCCTCCTGCCCACTGCGCGGGG + Intergenic
1073094132 10:100969632-100969654 GACCCCCGGCCCGCAGCCCCAGG - Intronic
1074052731 10:109894680-109894702 GGCCACCTGCCCACTAGCCCAGG + Intronic
1074105451 10:110386215-110386237 TCCCTCCTCCCCACAGCCCCTGG + Intergenic
1074275748 10:112000224-112000246 GTCTTCCAGCCCTCTGCCCCAGG - Intergenic
1074365678 10:112855700-112855722 GACCTCCTGCCCACAGAGCTTGG + Intergenic
1074377646 10:112952264-112952286 GCCCTCCTTCCCCCTTCCCCTGG + Intronic
1075718102 10:124568739-124568761 GGCCTCCTCCTCACTGCCCTGGG - Intronic
1075798008 10:125134884-125134906 TGCCCCCTGCCCCCTGCCCCCGG + Intronic
1076022998 10:127089595-127089617 CTGCCCCTGCCCACTGCCCCTGG + Intronic
1076512539 10:131022751-131022773 GACATCCTGCCCTGTGTCCCAGG - Intergenic
1077109929 11:857888-857910 GACCTCCTGCCCTCATCACCTGG + Intronic
1077441574 11:2571509-2571531 GCCTTGGTGCCCACTGCCCCCGG + Intronic
1077445756 11:2589937-2589959 GACCTCCTGCCCACTGGCCACGG + Intronic
1078026075 11:7696777-7696799 GACATCCTGCTCACTGCACCAGG + Exonic
1078065149 11:8073773-8073795 GTCCTCTTGCCCACTTGCCCAGG - Intronic
1078771762 11:14358627-14358649 GCCCTCCCGCCCCCTGGCCCCGG + Intronic
1079248439 11:18770301-18770323 GTCCTCCTCCCCACAGCCCCTGG + Intronic
1080847136 11:36036291-36036313 GACCTGCTCCCCTCTGCCCCAGG - Intronic
1081576061 11:44319225-44319247 GCCCTCCTGCCGCCTGCCTCCGG + Intergenic
1081982081 11:47273731-47273753 GACCTTCTGACCTCTGCCTCTGG + Intronic
1083212260 11:61195555-61195577 CACCCCCAGCCTACTGCCCCTGG + Intergenic
1083763834 11:64832875-64832897 GACCTCCTCCGCACAGCCCTGGG - Exonic
1083854026 11:65383308-65383330 GACCTCCTACCTCCTGCCTCTGG + Intronic
1083893747 11:65610054-65610076 CAACCTCTGCCCACTGCCCCTGG + Intronic
1083970535 11:66071072-66071094 GACCTTCTGGCCTCGGCCCCGGG + Intronic
1084332271 11:68437156-68437178 GTCCTCCTGGCCGCTGCCCTGGG - Intronic
1084493257 11:69489574-69489596 GAGCACGTTCCCACTGCCCCAGG - Intergenic
1084689463 11:70716609-70716631 GACCACCCGCCCTCCGCCCCTGG + Intronic
1085037830 11:73310346-73310368 GAGCTCCTGCTCACAGGCCCTGG + Exonic
1085382009 11:76128349-76128371 GCCCCCCTGCCCACGGCCCATGG + Intronic
1085397732 11:76215530-76215552 GAACCTCTGCCCACTGCCCAGGG + Intergenic
1085406643 11:76267094-76267116 GGACTGCTGCCCACTGCCCAGGG - Intergenic
1085697289 11:78715832-78715854 GTCCTCCTGCCACCTGGCCCTGG + Intronic
1086233935 11:84604353-84604375 ACCCTACTCCCCACTGCCCCAGG - Intronic
1086379889 11:86241373-86241395 CCCCTCCTCCCCATTGCCCCTGG + Intergenic
1087118106 11:94544976-94544998 GACCTCCAGCCCCAGGCCCCCGG + Exonic
1088923673 11:114280267-114280289 TCCCTCCAGCCCTCTGCCCCAGG - Intronic
1088987735 11:114924857-114924879 GGCCTCCTAGCCACTGCTCCAGG - Intergenic
1089133557 11:116231400-116231422 GACCTCCAGGCCACTGACCTTGG + Intergenic
1089198742 11:116710770-116710792 CAGGGCCTGCCCACTGCCCCAGG + Intergenic
1089356022 11:117854383-117854405 GAACTGCTGCCCATTGTCCCTGG - Intronic
1089518462 11:119048458-119048480 TGCCTCCTGCCCACTGACCTGGG + Exonic
1090415082 11:126535038-126535060 CACCTCCTGCCCACCTCCCTAGG - Intronic
1091169374 11:133506810-133506832 GTTCTCCTGCCTTCTGCCCCAGG - Intronic
1091267505 11:134282360-134282382 GACCGCATGCCCAAGGCCCCAGG - Intronic
1094743896 12:33320731-33320753 GAAATCCAGCCCACTTCCCCAGG + Intergenic
1095084703 12:38048874-38048896 GGCCACCTGCCCACAGCCCAGGG - Intergenic
1095976345 12:47943137-47943159 GCCCTCCTCCCCACTGCGCCAGG + Intergenic
1103415953 12:120741561-120741583 CACCCCCTCCCCACTGTCCCCGG - Intergenic
1103521976 12:121542225-121542247 GGCCTCCTGCCAACAGCCACGGG + Intronic
1104003216 12:124873689-124873711 GCCCTCCTCCCCTCAGCCCCAGG + Intronic
1104402610 12:128489095-128489117 CACCTGCCGCCCACTGCCCGGGG - Intronic
1104559976 12:129834613-129834635 GTCCTGCTGCTCACTGCCCAGGG - Intronic
1104811208 12:131621302-131621324 GACCCCCTCTCCCCTGCCCCGGG - Intergenic
1104881201 12:132071711-132071733 GCCCTGCTGCCCACGGCTCCTGG + Intronic
1105606504 13:21930590-21930612 GGCCTCCTGCCCCCAGCCCACGG - Intergenic
1105731968 13:23226739-23226761 TTCCTCCTGCCCCCAGCCCCTGG - Intronic
1105859417 13:24395600-24395622 TTCCTCCTGCCCCCTGCCCCAGG + Intergenic
1107451281 13:40512377-40512399 GTTCTCCTTCCCCCTGCCCCCGG - Intergenic
1108417144 13:50209184-50209206 TACCCCCAGCCCCCTGCCCCTGG - Intronic
1108706233 13:52990674-52990696 GCCCTCCAACACACTGCCCCCGG + Intergenic
1109722705 13:66295831-66295853 CAACTGCTGCCCCCTGCCCCGGG - Intergenic
1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG + Intergenic
1111645466 13:91026736-91026758 GACTTCTTACCCACTTCCCCAGG - Intergenic
1112632421 13:101177109-101177131 GGCCTCCTGCCAACAGCCACTGG + Intronic
1113074616 13:106455384-106455406 GCCCTACTGCCCACTGCCCAGGG + Intergenic
1113302125 13:109033770-109033792 CACCTCCTGCCCTCAGCTCCTGG - Intronic
1113941039 13:114018721-114018743 CACCTCCTGCCCACACCCACAGG + Intronic
1114050003 14:18914564-18914586 TACCGCCAGCCCGCTGCCCCTGG - Intergenic
1114112555 14:19487367-19487389 TACCGCCAGCCCGCTGCCCCTGG + Intergenic
1118332005 14:64822480-64822502 AACATCCTCCCCACTGCCTCAGG - Intronic
1121636704 14:95458584-95458606 GAGGCCATGCCCACTGCCCCAGG + Intronic
1121693575 14:95894871-95894893 GACCTCCTGTCCTCAGCCACAGG + Intergenic
1122299926 14:100725697-100725719 CCCCTCCTCCCCATTGCCCCCGG - Intronic
1122376402 14:101262530-101262552 GAACTCCTGTCCACTGCCAGTGG - Intergenic
1122542445 14:102505847-102505869 GACCTTCAGCCCTCTGCTCCTGG + Exonic
1122633850 14:103121306-103121328 AGCCCCCTGCTCACTGCCCCTGG + Intergenic
1122847240 14:104506617-104506639 TTCCTCCTGCCCCCTGCCCCAGG + Intronic
1122969826 14:105147984-105148006 TGCCCCCTGCCCCCTGCCCCCGG - Intronic
1124608519 15:31191419-31191441 TCCCTCCTGCCCCCAGCCCCTGG - Intergenic
1125482379 15:40089493-40089515 GACCACCTTCCACCTGCCCCAGG + Exonic
1126530881 15:49710471-49710493 GATCACCTACCCACTGACCCAGG - Intergenic
1126658477 15:51006991-51007013 GCCCTCCTGCCCCCAACCCCTGG + Intergenic
1127785178 15:62349432-62349454 ATCCCCCTGCCCACAGCCCCTGG + Intergenic
1128338263 15:66802422-66802444 AAGCAGCTGCCCACTGCCCCAGG + Intergenic
1128739413 15:70073333-70073355 GACCTCCAGGTCTCTGCCCCAGG + Intronic
1129296316 15:74602240-74602262 GCCCCCCTGCCCCCTGCCCCAGG + Intronic
1130329846 15:82913480-82913502 GACCTACTGCCTACAGCCCAGGG + Intronic
1130360344 15:83179158-83179180 AACCTGCCTCCCACTGCCCCTGG + Intronic
1132147264 15:99436381-99436403 TCCCTCCTGCCCCCTGCCCCTGG + Intergenic
1132231911 15:100190653-100190675 CACCTACTGCCCACTGCCAGTGG - Intronic
1132320444 15:100920898-100920920 GACCACCAGGCCATTGCCCCAGG + Intronic
1132391985 15:101445947-101445969 GCCATCCAGCCCCCTGCCCCGGG + Intronic
1132519013 16:378923-378945 GACATCCTGCTCATGGCCCCAGG + Intronic
1132829883 16:1922836-1922858 AACTTCCTTCCCTCTGCCCCAGG + Intergenic
1132873077 16:2124204-2124226 GCCCTGCTGCCCACAGCCCTGGG - Intronic
1133421997 16:5653858-5653880 GCCCTCCTGCCCACTGGTCTTGG - Intergenic
1133740059 16:8644680-8644702 GGCCTCCTTCCCACAGCTCCTGG + Exonic
1134552166 16:15143385-15143407 GCCCTGCTGCCCACAGCCCTGGG - Intergenic
1136025277 16:27464618-27464640 CACCTCCTTCTCACAGCCCCCGG - Exonic
1136125293 16:28175175-28175197 GGCCTCCTGCCCCCATCCCCTGG + Intronic
1136174249 16:28506592-28506614 GACCACCACCCCACTGCCCCAGG + Intronic
1136358617 16:29763043-29763065 GATCTCCTACCCCCTGCCCCTGG + Intergenic
1136605648 16:31331553-31331575 GCCCTCCCGCCCCCTCCCCCTGG + Intronic
1137031767 16:35531401-35531423 ACCCTCCTGCCCTCTGCCCACGG + Intergenic
1137531940 16:49283350-49283372 GCGCTCCTGCCCTCTGCCTCTGG + Intergenic
1137539361 16:49351497-49351519 GAGCCCCTGCACACAGCCCCAGG + Intergenic
1137988802 16:53131528-53131550 GCCCCCCGGCCCACAGCCCCCGG + Intronic
1139436988 16:66942041-66942063 GACCACCTCCTCCCTGCCCCTGG + Intronic
1139673346 16:68506590-68506612 GTCCTCCTTCCCACAGTCCCTGG - Intergenic
1139691033 16:68642293-68642315 GAACCACTGCCCACTGCGCCGGG + Intronic
1139952205 16:70677944-70677966 GCCCGCCTGCCCAGCGCCCCTGG + Intronic
1140301665 16:73763911-73763933 GTCCTCCCACCCCCTGCCCCTGG - Intergenic
1141519170 16:84566292-84566314 GACCTCCTGGTATCTGCCCCGGG - Exonic
1141820800 16:86444204-86444226 AGCCCCCTGCCCACTGCCTCAGG - Intergenic
1141984323 16:87570334-87570356 GACCTGCTGCCCACAGCCTCGGG + Intergenic
1142434097 16:90046402-90046424 GGGGTCTTGCCCACTGCCCCAGG - Intergenic
1142638432 17:1271454-1271476 GAGCTCCTTCTCTCTGCCCCAGG - Exonic
1142709070 17:1713898-1713920 GAACTGTTGCCCTCTGCCCCTGG - Intergenic
1142858146 17:2744474-2744496 GACCTCCTGCTTCCAGCCCCCGG + Intergenic
1144627976 17:16854833-16854855 GACCTCCTGGAATCTGCCCCGGG + Intergenic
1144779326 17:17799950-17799972 CACCTGCTTCCCACTGCCCATGG + Intronic
1145159568 17:20565414-20565436 GACCTCCTGGAGTCTGCCCCGGG + Intergenic
1145238272 17:21224193-21224215 TCCCTCCTGCCCCCAGCCCCTGG - Intergenic
1145924060 17:28632907-28632929 CCCTTCCTCCCCACTGCCCCAGG + Intronic
1146455115 17:33003896-33003918 CACCCCCTGCCCCATGCCCCCGG + Intergenic
1146762414 17:35490082-35490104 CCCCTCCTCCCCAGTGCCCCAGG + Intronic
1146793121 17:35764197-35764219 GTCCTACTGCCCGCTGCGCCAGG + Exonic
1148216117 17:45834858-45834880 GGTCTCATGCCCACTCCCCCAGG + Exonic
1148231901 17:45941455-45941477 CCCCTCCTTCCCCCTGCCCCTGG + Intronic
1148843751 17:50516350-50516372 GTCCCCCTACCCACAGCCCCTGG - Intronic
1149424288 17:56540089-56540111 GTCCTGCTGCTCACTGCCACAGG - Intergenic
1149606277 17:57927287-57927309 CTCCTCCTCCCCACTCCCCCCGG + Intronic
1149993820 17:61396868-61396890 TTCCTGCTGCCCACTGCCCGCGG + Intergenic
1151135508 17:71942741-71942763 AACCTCCTCCCCACTAGCCCTGG + Intergenic
1151155537 17:72121362-72121384 GGCCACCAGCCCCCTGCCCCGGG + Exonic
1151467656 17:74297980-74298002 GACCTGCTGCCTCCTGCCCAGGG + Intronic
1151472797 17:74328270-74328292 GACCTGCTGCCCTCTGACCTAGG + Intronic
1151499626 17:74480523-74480545 GCCCACCTGCCTGCTGCCCCAGG - Intronic
1151518448 17:74612411-74612433 GCCCTCATGCCCACTTCCCAAGG - Exonic
1152193003 17:78899782-78899804 GGCCTCGTTCCCACTCCCCCAGG + Intronic
1152361732 17:79836017-79836039 GCCCTCCTGCCCACGGCCTTGGG + Intronic
1152720801 17:81923057-81923079 GACCACCTGCACTGTGCCCCAGG - Exonic
1153949906 18:10049636-10049658 GTCCTCCTGCTCTCTGTCCCAGG - Intergenic
1154322576 18:13367153-13367175 AACCTCCTTCCCACAGCCACAGG - Intronic
1154357361 18:13632244-13632266 CTCATCCTGCCCACTTCCCCTGG + Intronic
1155072320 18:22327355-22327377 CTCGTCCAGCCCACTGCCCCTGG - Intergenic
1155972321 18:32093164-32093186 AACGGCCTGGCCACTGCCCCGGG - Intronic
1156472246 18:37384558-37384580 GACCTCCAGGCCAGTGTCCCAGG - Intronic
1159546012 18:69839805-69839827 CACCTCCTGCCCCACGCCCCTGG - Intronic
1160346286 18:78135075-78135097 GATCTCCTTCCCATTTCCCCAGG - Intergenic
1160410643 18:78673440-78673462 GACGTCCTACCCACTGTGCCAGG + Intergenic
1160458422 18:79019202-79019224 GACCTCCTGCCCCCTGTCTCTGG + Intergenic
1160903611 19:1441372-1441394 ACCCTCCTGTCCACTGCCCAAGG - Intergenic
1160941419 19:1622025-1622047 CACCCCCTGCCCCCTGCCCTGGG + Intronic
1161048303 19:2148920-2148942 TCCCTCCCGCCCACTGCACCCGG - Intronic
1161087843 19:2343388-2343410 GTGCTCCTGCTCACTGCCCTGGG + Intronic
1161200918 19:3014384-3014406 GACCTCCTCTCCACTGCACAGGG - Intronic
1161250900 19:3279680-3279702 GGCCTCCTGGCCCCTGCCTCAGG + Intronic
1161256938 19:3314882-3314904 CCCCTCCTGCCCCCGGCCCCGGG - Intergenic
1161341367 19:3744702-3744724 GAACTCCTGACCACTGCGCCCGG - Intronic
1161468668 19:4445761-4445783 GGCCTCCTGCCCTCTCCCTCCGG + Intronic
1162069574 19:8145752-8145774 TGCCACCTGCCCACTGCCCAGGG - Intronic
1162371143 19:10280187-10280209 GACTTCCTCCCCGCTGCACCAGG + Intronic
1162411788 19:10510507-10510529 GACGTGCTGGCCCCTGCCCCCGG - Intergenic
1162433356 19:10642634-10642656 GACCTCCTGTCCACTGGCCCAGG + Intronic
1162937137 19:13986903-13986925 GACCCTCTGCCTCCTGCCCCTGG + Intronic
1162947352 19:14052022-14052044 CACCCCCTCCCCACTGCCCCAGG - Intronic
1163099475 19:15085690-15085712 CACCTCCCGCCCCCAGCCCCTGG + Intergenic
1164671775 19:30076532-30076554 GACCCCCAACCCACTGGCCCAGG + Intergenic
1164866236 19:31606651-31606673 TACCACCTCCCCACTGCCCTTGG + Intergenic
1165036377 19:33036736-33036758 GACGTCCGGCCCGCTGGCCCCGG + Intronic
1165715928 19:38045894-38045916 GACTTTCTTCCCACAGCCCCTGG + Intronic
1165866732 19:38944019-38944041 GACCTCCCTCCCCCAGCCCCTGG + Intronic
1166054016 19:40277942-40277964 CACCCCCTCCCCACTGCCCTAGG - Intronic
1166063439 19:40342018-40342040 GACTTCCTGCCAGCTGCTCCAGG - Intronic
1166089194 19:40497378-40497400 GCCCTTCTGCCCATTGCCCTGGG + Intronic
1166373468 19:42314712-42314734 CAGCACCTGCCCACTCCCCCAGG - Intronic
1166381727 19:42358357-42358379 GTCCTCTTTCCCAGTGCCCCAGG + Intronic
1166566237 19:43767216-43767238 GCCCTCCTGCCCCCTGGCCTCGG - Intronic
1167144683 19:47674694-47674716 GGCCTCCTGCCAACAGCCACAGG - Intronic
1167933814 19:52890432-52890454 CCTCTGCTGCCCACTGCCCCAGG + Intronic
1168278432 19:55289889-55289911 CCCCTCCTGCCCCCAGCCCCCGG + Intronic
1168300844 19:55404244-55404266 GGCCTCCTGCCTCCTGCCTCTGG - Intronic
1168386638 19:55968851-55968873 CAGCTCCTGACCACTGCCCTGGG + Intronic
924982962 2:239979-240001 GACTTCCTTCCCCCAGCCCCTGG + Intronic
925734325 2:6948032-6948054 GACCTCCTTCCCTCTTCCCTCGG - Intronic
926013052 2:9423487-9423509 GCCCTCCTGCCCACGTCCGCCGG + Intronic
926087220 2:10028087-10028109 GGCCTCCAGCCCACAGCCACAGG + Intergenic
926803953 2:16687337-16687359 GCTCTCCTGGTCACTGCCCCTGG + Intergenic
927150589 2:20193156-20193178 GTCCTCCTGCCCTCTGGCCCTGG + Intergenic
927462269 2:23309632-23309654 GACCGCCTCCCACCTGCCCCAGG + Intergenic
928174812 2:29026437-29026459 GACATCCCACCCACTGCCCAAGG - Intronic
928269607 2:29844325-29844347 CACCTGCTCCCCACTGGCCCCGG - Intronic
929174146 2:38960103-38960125 GAGCTCCTGCCCGATGCCCGCGG + Exonic
929863155 2:45696415-45696437 TGCCTCCTGCCAAATGCCCCAGG - Intronic
930905290 2:56559002-56559024 GCTCGCCTGCCCACTTCCCCAGG - Intergenic
931602729 2:64019681-64019703 AACCTCCTGCCGCCTTCCCCGGG + Intergenic
931781115 2:65580077-65580099 GCCCTCCTCCCCACTGTCTCAGG + Intergenic
932406201 2:71513833-71513855 GTCCTCCGCCCCACTACCCCGGG + Exonic
932437991 2:71714292-71714314 GCCCTGCTGTCCACTGCCCCAGG - Intergenic
932572962 2:72947550-72947572 CACCTTCTGCCCACTTCCCAGGG - Intronic
932750026 2:74365687-74365709 GACATCCTCCCCACAGTCCCTGG + Intronic
932777299 2:74535899-74535921 GGCCCCCAGCCCATTGCCCCAGG - Intronic
933544932 2:83697768-83697790 GACCTCCTCCCCAGTGGGCCTGG + Intergenic
934045778 2:88171397-88171419 ATCCTCCTTCCCAGTGCCCCAGG + Intronic
934620057 2:95798285-95798307 GAGCTCCTGTCCACAGCCCCAGG - Intergenic
934640831 2:96026272-96026294 GAGCTCCTGTCCACAGCCCCAGG + Exonic
936073204 2:109384801-109384823 GGCCTTCTGCCCACATCCCCAGG - Intronic
937125583 2:119473329-119473351 TACATCCTGACCACTGTCCCAGG + Intronic
937142722 2:119615956-119615978 TCCCTCCTCCCCACAGCCCCTGG + Intronic
937284614 2:120742017-120742039 GCCCTCTTGCCCGCTTCCCCAGG + Intronic
937916952 2:127103920-127103942 GGCCCCCTGGCCACTGCCCCCGG - Intronic
938683146 2:133712480-133712502 GACCTTCTGCCCAGAGCACCTGG + Intergenic
939969638 2:148644878-148644900 CTCCTCCTCCTCACTGCCCCCGG - Intronic
940515870 2:154683559-154683581 GACCTCCTCTCAACTGCCCATGG + Intergenic
941003166 2:160222042-160222064 ATCCTCCTGCCTACTCCCCCTGG + Intronic
942101268 2:172586367-172586389 GACCTCCCGCGCAGTGCCTCTGG + Exonic
942247771 2:174023709-174023731 GACCTTCTGTCCCCTTCCCCAGG - Intergenic
945130815 2:206569992-206570014 GCCCCCCTCCCCACTGCCCCTGG + Intronic
945538344 2:211049284-211049306 GACCTCCTGCCCCCTGAACCTGG + Intergenic
946400508 2:219466150-219466172 TGCCTCCTGCCCACAGACCCAGG + Intronic
946929710 2:224659694-224659716 CACCTCCTTCCCCCAGCCCCAGG + Intergenic
947390577 2:229635257-229635279 GACCTCCAGCCCTCTGGCCAGGG + Intronic
947615818 2:231556324-231556346 GACCTGCTGCCCACCCACCCTGG + Intergenic
947701746 2:232240174-232240196 CACCTCCTCTCCCCTGCCCCAGG + Intronic
947744619 2:232501219-232501241 GAGCCCCTTCCCCCTGCCCCTGG + Intergenic
947769908 2:232662367-232662389 CTCCTCCTGGTCACTGCCCCTGG - Intronic
947869362 2:233424593-233424615 TGCCTCCGGCCCACTGGCCCTGG + Intronic
948000108 2:234560682-234560704 GACTTCTTGCCCACCGCCCTGGG - Intergenic
948151699 2:235749608-235749630 GTCCTGCTGCCCTCTGCCTCAGG + Intronic
948273616 2:236692043-236692065 GGCCTCCTTCTCACTGCCACAGG + Intergenic
948596518 2:239082863-239082885 GACCACCTGCCCTGTGGCCCGGG - Intronic
948860597 2:240750946-240750968 TGCCTCCTGCCCACTTCCCAGGG + Intronic
948870520 2:240795676-240795698 GGCCGCCTACCCAGTGCCCCTGG + Intronic
949041938 2:241853510-241853532 GCCCCACTGCCCACTGCCCAGGG - Intronic
1172170591 20:32929349-32929371 AACCTGCTTCCCACTGGCCCCGG - Intronic
1172434003 20:34915359-34915381 AACCTCCTTCCCCTTGCCCCTGG + Intronic
1172436841 20:34934851-34934873 GACCTCCAGCTCACTGCCCATGG + Intronic
1172767092 20:37356645-37356667 GAGCCCTTGCCCAATGCCCCAGG - Intronic
1172784492 20:37458129-37458151 GGCCTCCTGCCAACAGCCCTGGG - Intergenic
1174145091 20:48447797-48447819 GACTTGGTGCCCATTGCCCCAGG - Intergenic
1174171516 20:48620600-48620622 GGCCTCCTGCCCAGAGCTCCTGG - Intergenic
1174401849 20:50280258-50280280 CACCTCCTGCCCCCAGCCCAGGG + Intergenic
1174456918 20:50655360-50655382 GTCCCCCTGCCCAGCGCCCCAGG + Intronic
1175259450 20:57665380-57665402 GTCCGCCCGCCCCCTGCCCCGGG + Intronic
1175507823 20:59498499-59498521 GACCGCCTGCCCTCTGACCTGGG + Intergenic
1176259124 20:64169974-64169996 GCCTTCCTGCCGAGTGCCCCAGG + Intronic
1179319053 21:40272177-40272199 GACATCCTGCCCTATGCTCCAGG - Intronic
1179890194 21:44331377-44331399 GACCCGCTGCCAACTGCCCTGGG + Intronic
1180236030 21:46459540-46459562 GACCTCCTGCCCCTCACCCCCGG + Intronic
1180468482 22:15636939-15636961 TACCGCCAGCCCGCTGCCCCTGG - Intergenic
1180920744 22:19520263-19520285 GAGCTCCTGCCCCCTGGCCCGGG - Intronic
1180937934 22:19638170-19638192 GGCTTCCTGTCCACTGCCCAGGG - Intergenic
1180937953 22:19638230-19638252 CAGCTCCTGGCCACTGCCCATGG - Intergenic
1180977335 22:19855488-19855510 GACTGCCTGCCCCCTGCCTCTGG - Intergenic
1180980611 22:19876432-19876454 GGGCTCCTGGCCTCTGCCCCAGG - Intronic
1180995412 22:19963001-19963023 GCCCTGCTGCCTGCTGCCCCAGG + Intronic
1181031580 22:20150784-20150806 GGCCCACTGCCCCCTGCCCCTGG + Exonic
1181578990 22:23816545-23816567 GACCTCCTGCTCCATGCCCTGGG - Intronic
1182015862 22:27039233-27039255 CAGCTCCTGCCCTCAGCCCCAGG + Intergenic
1182044074 22:27260543-27260565 CACCCCCTCCCCACTGCCCCTGG - Intergenic
1182299790 22:29331061-29331083 GACGGCCTGCACCCTGCCCCTGG - Intronic
1182304914 22:29361251-29361273 GACCTCCTGCCAGCAGCTCCGGG - Intronic
1182312228 22:29417386-29417408 GACCTCCTGCCAGCAGCTCCGGG - Intronic
1182688039 22:32135856-32135878 GACCTCCTGCCAGCAGCTCCGGG + Intergenic
1183781788 22:40003527-40003549 GACCACCTGCCCCCTGCTCAGGG + Intronic
1184146502 22:42614613-42614635 GACCGCCCGCCCACTGGCCGAGG - Intronic
1184151900 22:42644265-42644287 GAGCACCTGCCCCCAGCCCCGGG + Intronic
1184389068 22:44192632-44192654 TACCTCCTGCCCACTGGGCATGG + Intronic
1184738396 22:46412402-46412424 GTCCTCCTGACCACGGCACCTGG + Intronic
1184742499 22:46437211-46437233 GACCCCCTGCCCGGGGCCCCTGG - Intronic
1184960137 22:47922655-47922677 GACCACCTGCCCACTGCCTATGG - Intergenic
1185066317 22:48633296-48633318 GACCACCTGCCCAGTCTCCCAGG - Intronic
950422677 3:12907911-12907933 GCCCCCTTGCCCACTGTCCCCGG - Intronic
951400496 3:22227323-22227345 GTCCTCCTGCCATCTGCCCAAGG + Intronic
951422129 3:22499158-22499180 CACCTCCTGCCCACTTCTGCAGG - Intergenic
952386939 3:32848736-32848758 CACAGCCTGGCCACTGCCCCAGG - Intronic
953768038 3:45759159-45759181 CACCTGCTGAGCACTGCCCCTGG + Intronic
954107349 3:48416415-48416437 CACCTCCTCCCCACTGGCCCCGG + Exonic
954117812 3:48476849-48476871 GCCCTGCTGCCTCCTGCCCCAGG - Intronic
954244017 3:49316733-49316755 GAACCCCTGCCCCCTGCCCTGGG + Intronic
954361735 3:50125842-50125864 GGCCTCCTCCTCACTGCCACAGG - Intergenic
955003832 3:54951462-54951484 GCCCCCCACCCCACTGCCCCCGG - Intronic
956763877 3:72467565-72467587 GATCTCCTTCCTTCTGCCCCAGG - Intergenic
956869148 3:73399399-73399421 GAAATTCTGCCCACTCCCCCAGG + Intronic
957743069 3:84299743-84299765 AAGCTCCTGCCCCCTGCCACAGG + Intergenic
961454185 3:127016155-127016177 GGCCTGCTGCCTACTGCCTCTGG + Intronic
961463884 3:127070013-127070035 GATCGCCTGCACACTGGCCCTGG + Intergenic
963321159 3:143811063-143811085 GAACTCTGGTCCACTGCCCCCGG - Intronic
964812319 3:160678983-160679005 GCCCTCCTGTCCAATGCCTCTGG - Intergenic
966378708 3:179322918-179322940 GACCACCGGCCCGCAGCCCCGGG - Intergenic
966440842 3:179942561-179942583 CACCTCCCTCCCACTGCACCCGG + Intronic
968659384 4:1792966-1792988 GAGCTCCTGAGCACAGCCCCAGG + Intergenic
968756214 4:2417772-2417794 GACCCTCTCCCCACTTCCCCAGG - Intronic
968936341 4:3612387-3612409 GTCCTCCTGCCCAGTGGCCTGGG - Intergenic
968971935 4:3800381-3800403 CTCCTCCTGCCCCCTGCACCTGG - Intergenic
969311848 4:6357544-6357566 GCCCTGCCGCCCACAGCCCCAGG + Intronic
969491262 4:7500384-7500406 GACCTCCTGCAAACAGGCCCTGG + Intronic
969655826 4:8497942-8497964 CAGCTCCTGCTCCCTGCCCCTGG - Intergenic
969872900 4:10116011-10116033 CACCTCCTGCCCATTGGCCCGGG - Intronic
973041461 4:45474906-45474928 TACCTCTTGCCCTGTGCCCCCGG + Intergenic
977317348 4:95467051-95467073 GGCCTCCTGCCAACAGCCACAGG + Intronic
978043850 4:104101928-104101950 GAGGTCCTGGCCACTGCCCTAGG + Intergenic
978102293 4:104857095-104857117 GAGCTACTGCCCACTGCCTCAGG + Intergenic
979754295 4:124321552-124321574 GACCTTCTTCCCACTGCCTATGG + Intergenic
980729941 4:136812127-136812149 GACCTGGAGCCCCCTGCCCCAGG - Intergenic
983646171 4:169993669-169993691 TTCCTCCTGCCCACTGGCCAGGG + Intronic
985451062 4:190062894-190062916 CACCTGCTTCTCACTGCCCCTGG - Intergenic
985574987 5:669812-669834 GAACTCCTGAGGACTGCCCCAGG - Intronic
985678486 5:1244192-1244214 CACCCCTTTCCCACTGCCCCAGG + Exonic
985880024 5:2632118-2632140 GACCTACTGCCCACTCCAGCAGG - Intergenic
986046264 5:4041332-4041354 TACCTCATGCCCACTGCCTCTGG + Intergenic
987048536 5:14129779-14129801 TACCTCCCGACCCCTGCCCCAGG + Intergenic
988705985 5:33726298-33726320 CACCTGCAGCCCTCTGCCCCAGG - Intronic
989063259 5:37431715-37431737 TTCCTCCTGCCCCCAGCCCCTGG + Intronic
992527659 5:77628366-77628388 GCCCTCCGCGCCACTGCCCCAGG + Intergenic
992894546 5:81234921-81234943 GAGCTCCTGCCCACAGAGCCAGG + Intronic
993324753 5:86519874-86519896 GACCTTCTTCCCCCTCCCCCAGG + Intergenic
993547295 5:89229303-89229325 ACCCTCCAGCCCACTGACCCAGG - Intergenic
993993352 5:94687371-94687393 TACCTTCCCCCCACTGCCCCTGG - Intronic
994332781 5:98526846-98526868 CAGCTTCTGCCCACAGCCCCTGG + Intergenic
996117336 5:119633203-119633225 GGCCTCCTGCCCCCTACCCAAGG - Intronic
997294821 5:132762745-132762767 GGCCTCCTTCCCCCTGCCCAGGG - Intronic
997530699 5:134579632-134579654 GGACTCCAGCCCACTGCCACTGG + Exonic
997882077 5:137600297-137600319 CACCTCCTTCCCCCTGCCCCAGG - Intergenic
998213213 5:140217381-140217403 GACATCTTGCCCACAGCCCTGGG - Intronic
999070267 5:148736959-148736981 GTCCTCCTGCCCACTAGCCTGGG + Intergenic
999091108 5:148936576-148936598 TAGCTCCTGCCCATTGTCCCTGG - Intronic
999256851 5:150214413-150214435 GAGCTCCAGCCCACTCCCTCTGG + Intronic
1000137202 5:158364453-158364475 CAGCTCCTGCCCACAGCCCCGGG - Intergenic
1001544485 5:172562307-172562329 TCTCTCCTGCCCACTGCCCATGG - Intergenic
1001777147 5:174337415-174337437 GTCCTCCTGCCCCCTGCAGCTGG - Intergenic
1001959367 5:175871209-175871231 GACATCCTGGCCACAGCTCCAGG - Intronic
1002330503 5:178437402-178437424 GACCTCCTGCTCCCTGGACCCGG - Intronic
1002603713 5:180370026-180370048 GACGTCCCTCCCACTGGCCCAGG - Intergenic
1003107661 6:3228158-3228180 TCCCTCCAGCCAACTGCCCCTGG + Intronic
1004075335 6:12339665-12339687 GAGGACCTGCCCTCTGCCCCAGG - Intergenic
1004924080 6:20402479-20402501 CCCCTCCTCCCCAGTGCCCCCGG + Exonic
1005197931 6:23310610-23310632 GACCTCCTGCCCACTGTGGAGGG - Intergenic
1005311073 6:24559861-24559883 CACCTCCTCCCCACAGTCCCGGG + Intronic
1006059625 6:31410676-31410698 CATCTTCTGCCCACTGTCCCTGG - Exonic
1006154252 6:32005773-32005795 CACCTCCTGCCTCTTGCCCCGGG + Intergenic
1006312827 6:33272955-33272977 TACCTCCTCCCCACTTCCCCAGG - Intronic
1006390667 6:33756391-33756413 GGCCTCCTGACTCCTGCCCCTGG - Intergenic
1006845470 6:37058380-37058402 GACCTGGTGACCACTGGCCCTGG + Intergenic
1007125348 6:39421633-39421655 AACCTCCTGTCCACAGTCCCAGG - Intronic
1007481183 6:42151137-42151159 GCCCTCCTGCCCCCTGCTCTAGG - Intergenic
1013087050 6:106865793-106865815 GACCTCCTTCTCAATGCCTCTGG - Intergenic
1013233125 6:108174814-108174836 GACCTCCTGCTCTCTGTTCCAGG + Exonic
1015933152 6:138382727-138382749 CCCCTACTCCCCACTGCCCCCGG + Exonic
1016556290 6:145341908-145341930 GACCTCCTGACCTCGGCCGCTGG - Intergenic
1018131262 6:160734267-160734289 GAACACCTGCCCATCGCCCCAGG + Intronic
1018756116 6:166851120-166851142 GACCTCCTGCCCACTTCCCAGGG + Intronic
1019166355 6:170100194-170100216 GTCCTCATCCCCGCTGCCCCTGG + Intergenic
1019183692 6:170208721-170208743 GAGCATCTGACCACTGCCCCCGG + Intergenic
1019478228 7:1254392-1254414 GACCACCTTCTCAATGCCCCGGG + Intergenic
1019734358 7:2643561-2643583 CGTCCCCTGCCCACTGCCCCTGG + Intronic
1019760920 7:2812004-2812026 CAGCCCCTTCCCACTGCCCCTGG - Intronic
1019804919 7:3116757-3116779 GACCTGCAGGCCAGTGCCCCAGG - Intergenic
1020116557 7:5479613-5479635 GACCAGCTGCCCACGGCCCCAGG - Intronic
1020135812 7:5587259-5587281 GACCTCCCCACCACTGCTCCAGG - Intergenic
1022115474 7:27256930-27256952 GACCTCCTGGCCTCTGCCATTGG - Intergenic
1022840600 7:34160681-34160703 GAGCACCTGCTCACTGCCCAAGG - Intergenic
1023306429 7:38833440-38833462 GACCTCATCCCCTCTTCCCCTGG + Intronic
1023559721 7:41461064-41461086 TTCCTCCTGCCCCCAGCCCCTGG - Intergenic
1024300800 7:47885961-47885983 AACCTGCTGCCCACTGAGCCTGG - Exonic
1024306819 7:47936323-47936345 TTCCTCCTCCCCACAGCCCCTGG + Intronic
1024563057 7:50660572-50660594 GAGCTCCTGCCCACGGCACTTGG - Intronic
1025002820 7:55331533-55331555 GAGCTCCTGCCCACTGTTCAGGG + Intergenic
1025997334 7:66536278-66536300 GACCTCCTGCCCACTGCCCCTGG - Intergenic
1026990198 7:74580755-74580777 GACCTCCTGCCCACTGCCCCTGG - Intronic
1027266625 7:76498346-76498368 GAGCTCCTGCCCCCAGCCCAGGG + Intronic
1027318006 7:76996464-76996486 GAGCTCCTGCCCCCAGCCCAGGG + Intergenic
1029596028 7:101538054-101538076 CACCTCCTGCCCCCAGCCCCAGG + Intronic
1031386779 7:121161162-121161184 GAACACCGTCCCACTGCCCCTGG - Intronic
1031461791 7:122060227-122060249 GACCTCCTGCCAACTGGTCTAGG - Intronic
1032093138 7:128922011-128922033 AACCTCCTGCCCAGTCCCCAGGG - Intergenic
1033472354 7:141661458-141661480 GGCTTCCTGACCACTGTCCCGGG + Exonic
1034441117 7:151086575-151086597 GGCCTCCGGCCCCCGGCCCCCGG + Intronic
1036389651 8:8313571-8313593 TACCTCCTGACCACTTTCCCGGG + Intergenic
1036596384 8:10216576-10216598 GTCCTCCTTCCCCCAGCCCCTGG + Intronic
1037888765 8:22610187-22610209 GACCTACTTCCTACTACCCCTGG - Intronic
1038485854 8:27934735-27934757 TGCCTCCTGCCCCCTGCTCCAGG - Intronic
1038580923 8:28748671-28748693 GATCTCCTACCCGTTGCCCCGGG + Intronic
1039282218 8:35998042-35998064 GCCCTCCAGCCCACTGTCTCTGG + Intergenic
1040440795 8:47439680-47439702 GAGATCCTGCCACCTGCCCCAGG - Intronic
1041292352 8:56319762-56319784 GGCATCCTGCCCTCTGCTCCGGG + Intronic
1042962205 8:74315591-74315613 TGCCTCCGGCCCACTGGCCCTGG + Exonic
1043944198 8:86231369-86231391 ACCCTCCTTCCCTCTGCCCCTGG - Intronic
1044236712 8:89839620-89839642 GAGCCACTGCCCACTGCACCTGG - Intergenic
1047499296 8:125429890-125429912 TCCCTCCCGCCCACTTCCCCGGG + Intergenic
1049156500 8:141070297-141070319 GAACTCCTGACCACTGCACCTGG - Intergenic
1049216192 8:141409467-141409489 GACCTCCTGCCCACCCCTTCTGG + Intronic
1049337870 8:142096103-142096125 CCCCTCTTCCCCACTGCCCCAGG - Intergenic
1049369691 8:142257881-142257903 GTGCTCCCACCCACTGCCCCTGG + Intronic
1049574692 8:143384708-143384730 GACCTCCGCCCCCCTCCCCCTGG - Intergenic
1049670897 8:143869427-143869449 GGCCTCCTGCCCACAGGCCTGGG - Exonic
1051635102 9:19174375-19174397 AAGCTCCTGCCCAGTTCCCCCGG - Intergenic
1053478869 9:38401453-38401475 GACCCCATGCCCACTCCCACTGG - Intergenic
1053544645 9:39009922-39009944 GCCCACATGCCCACTGACCCAGG + Intergenic
1053809082 9:41833404-41833426 GCCCACATGCCCACTGACCCAGG + Intergenic
1054621510 9:67354024-67354046 GCCCACATGCCCACTGACCCAGG - Intergenic
1055972344 9:81924127-81924149 CACATCCTGACCACTGTCCCTGG - Intergenic
1055974097 9:81939199-81939221 CACATCCTGACCACTGTCCCTGG - Intergenic
1056654640 9:88499068-88499090 GGGCTCCTGCCCAGTGCCCTTGG - Intergenic
1057014890 9:91642736-91642758 GACCCTCTGCCCACTGCAGCCGG - Intronic
1057311742 9:93947495-93947517 GACCTCCCGCCCACTCCCATGGG - Intergenic
1057765616 9:97915517-97915539 GACCTCCTTGACTCTGCCCCTGG - Intronic
1057949259 9:99356754-99356776 CACCACCTGCCCTCTGTCCCCGG - Intergenic
1059289392 9:113209181-113209203 GAACTCCTGGCCACTGCACCTGG - Intronic
1059457897 9:114411418-114411440 GAGCCACTGCCCCCTGCCCCAGG + Intronic
1059458529 9:114414892-114414914 GACCTCCTGTCCCCCACCCCAGG - Intronic
1059744748 9:117189027-117189049 GACCTTCTACCCACTGTCCCAGG - Intronic
1060430099 9:123543668-123543690 TACTTCCTGCCCCCTGCTCCTGG + Intronic
1060945692 9:127568526-127568548 GACCCCCAGCCCACGACCCCTGG - Intronic
1061037721 9:128122743-128122765 GAGCTCCTGCTCACCTCCCCTGG - Intronic
1061225854 9:129280692-129280714 ACACTCCTGCCCACAGCCCCTGG + Intergenic
1061478985 9:130887106-130887128 GGCCACCTGCCCACTGCTCTCGG - Intronic
1061495932 9:130974161-130974183 GGCCTCATTCCCACGGCCCCCGG - Intergenic
1061880610 9:133567073-133567095 GACCCCCTGCCCAGGGCCCCTGG - Intronic
1062014335 9:134283751-134283773 GTCCTTGTGCCCACTGCCCTGGG + Intergenic
1062154014 9:135036142-135036164 ACTCTCCTGCCCCCTGCCCCTGG - Intergenic
1062216651 9:135393042-135393064 CCCCTCCTGCCCACTGCTCTGGG + Intergenic
1062369561 9:136230856-136230878 GACCTCCGTCCCACCACCCCTGG + Intronic
1062374479 9:136255772-136255794 GTCCTCCTGGCCTCTTCCCCAGG + Intergenic
1062397443 9:136358157-136358179 GGCCGCCTGCCCCCTGCTCCGGG - Exonic
1062600093 9:137315614-137315636 GTCCTGCTGCCCCCTCCCCCGGG - Intronic
1187092031 X:16106951-16106973 GACCTCCAGCCCAGTGCGTCGGG + Intergenic
1187646005 X:21348206-21348228 GACCTCCTACCCACAGCCAAGGG + Intergenic
1195427286 X:104748646-104748668 GGCCTCTTGCCCACAGCCCTGGG + Intronic
1195615590 X:106909544-106909566 GGCCTCCTGCCCTCAACCCCAGG - Intronic
1197107328 X:122731964-122731986 GACCTCCAGCCTGCTGCCACTGG - Intergenic
1197457890 X:126700929-126700951 GACCTCATGGCCACTGCCAGGGG - Intergenic
1198153050 X:133930209-133930231 GAGCTCCCCCCAACTGCCCCAGG + Intronic
1198874961 X:141214540-141214562 CACCTCCTGCTCTCTGCCACAGG - Intergenic
1199981192 X:152921385-152921407 GACAGCATGCCAACTGCCCCAGG + Intronic
1200060283 X:153480938-153480960 GGCCTCCTGTCCTCTGGCCCTGG - Intronic
1200215119 X:154364885-154364907 GCCCTCCAGCCCAGGGCCCCAGG + Exonic
1201339880 Y:12923032-12923054 AACCTCATGCCCACGGCCCTAGG - Intergenic
1201772200 Y:17625728-17625750 CACCTCCTTCTCACTGCACCTGG - Intergenic
1201829355 Y:18280258-18280280 CACCTCCTTCTCACTGCACCTGG + Intergenic