ID: 1025997339

View in Genome Browser
Species Human (GRCh38)
Location 7:66536308-66536330
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997328_1025997339 23 Left 1025997328 7:66536262-66536284 CCAAAGGCGTCACTGTCCAGGGG No data
Right 1025997339 7:66536308-66536330 CAGGGATGGGTTCTTTCAGCAGG No data
1025997325_1025997339 26 Left 1025997325 7:66536259-66536281 CCACCAAAGGCGTCACTGTCCAG No data
Right 1025997339 7:66536308-66536330 CAGGGATGGGTTCTTTCAGCAGG No data
1025997334_1025997339 7 Left 1025997334 7:66536278-66536300 CCAGGGGCAGTGGGCAGGAGGTC 0: 2
1: 0
2: 4
3: 52
4: 452
Right 1025997339 7:66536308-66536330 CAGGGATGGGTTCTTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997339 Original CRISPR CAGGGATGGGTTCTTTCAGC AGG Intergenic
No off target data available for this crispr