ID: 1025997604

View in Genome Browser
Species Human (GRCh38)
Location 7:66537851-66537873
Sequence TGCACCAGAGGCAGCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025997604_1025997610 6 Left 1025997604 7:66537851-66537873 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1025997610 7:66537880-66537902 GTTCCCAGAAGAGCTGGGATGGG No data
1025997604_1025997613 14 Left 1025997604 7:66537851-66537873 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1025997613 7:66537888-66537910 AAGAGCTGGGATGGGACTACAGG No data
1025997604_1025997609 5 Left 1025997604 7:66537851-66537873 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1025997609 7:66537879-66537901 AGTTCCCAGAAGAGCTGGGATGG No data
1025997604_1025997607 0 Left 1025997604 7:66537851-66537873 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1025997607 7:66537874-66537896 CTCACAGTTCCCAGAAGAGCTGG No data
1025997604_1025997608 1 Left 1025997604 7:66537851-66537873 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1025997608 7:66537875-66537897 TCACAGTTCCCAGAAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025997604 Original CRISPR TGCACCAGAGGCAGCTCCTT GGG (reversed) Intergenic