ID: 1025998626

View in Genome Browser
Species Human (GRCh38)
Location 7:66544173-66544195
Sequence GTTGTTTTGTGCCCAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025998623_1025998626 -10 Left 1025998623 7:66544160-66544182 CCTGCCTCTTTAGGTTGTTTTGT No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998614_1025998626 22 Left 1025998614 7:66544128-66544150 CCCTCTGGCTGGGAGACCCTCAG No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998619_1025998626 6 Left 1025998619 7:66544144-66544166 CCCTCAGGGGAGCAGCCCTGCCT No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998613_1025998626 23 Left 1025998613 7:66544127-66544149 CCCCTCTGGCTGGGAGACCCTCA No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998615_1025998626 21 Left 1025998615 7:66544129-66544151 CCTCTGGCTGGGAGACCCTCAGG No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998620_1025998626 5 Left 1025998620 7:66544145-66544167 CCTCAGGGGAGCAGCCCTGCCTC No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998622_1025998626 -9 Left 1025998622 7:66544159-66544181 CCCTGCCTCTTTAGGTTGTTTTG No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data
1025998612_1025998626 24 Left 1025998612 7:66544126-66544148 CCCCCTCTGGCTGGGAGACCCTC No data
Right 1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025998626 Original CRISPR GTTGTTTTGTGCCCAACACA GGG Intergenic
No off target data available for this crispr