ID: 1026004737

View in Genome Browser
Species Human (GRCh38)
Location 7:66591914-66591936
Sequence GCCGAGGGAAGCCGCCGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026004728_1026004737 8 Left 1026004728 7:66591883-66591905 CCAGCGTCCTGGACGGGGAAGTG No data
Right 1026004737 7:66591914-66591936 GCCGAGGGAAGCCGCCGCAGAGG No data
1026004723_1026004737 28 Left 1026004723 7:66591863-66591885 CCACAAATGTTGCTTCGGAACCA No data
Right 1026004737 7:66591914-66591936 GCCGAGGGAAGCCGCCGCAGAGG No data
1026004731_1026004737 1 Left 1026004731 7:66591890-66591912 CCTGGACGGGGAAGTGGGAGCCG No data
Right 1026004737 7:66591914-66591936 GCCGAGGGAAGCCGCCGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026004737 Original CRISPR GCCGAGGGAAGCCGCCGCAG AGG Intergenic
No off target data available for this crispr