ID: 1026009276

View in Genome Browser
Species Human (GRCh38)
Location 7:66624332-66624354
Sequence TTCAAGAGAAAACTCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026009276_1026009282 30 Left 1026009276 7:66624332-66624354 CCAACCCAGAGTTTTCTCTTGAA No data
Right 1026009282 7:66624385-66624407 AGTGCCTACTGATGTCCCCAGGG No data
1026009276_1026009281 29 Left 1026009276 7:66624332-66624354 CCAACCCAGAGTTTTCTCTTGAA No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026009276 Original CRISPR TTCAAGAGAAAACTCTGGGT TGG (reversed) Intergenic
No off target data available for this crispr