ID: 1026009277

View in Genome Browser
Species Human (GRCh38)
Location 7:66624336-66624358
Sequence GAAGTTCAAGAGAAAACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026009277_1026009282 26 Left 1026009277 7:66624336-66624358 CCCAGAGTTTTCTCTTGAACTTC No data
Right 1026009282 7:66624385-66624407 AGTGCCTACTGATGTCCCCAGGG No data
1026009277_1026009283 27 Left 1026009277 7:66624336-66624358 CCCAGAGTTTTCTCTTGAACTTC No data
Right 1026009283 7:66624386-66624408 GTGCCTACTGATGTCCCCAGGGG No data
1026009277_1026009281 25 Left 1026009277 7:66624336-66624358 CCCAGAGTTTTCTCTTGAACTTC No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026009277 Original CRISPR GAAGTTCAAGAGAAAACTCT GGG (reversed) Intergenic
No off target data available for this crispr