ID: 1026009279

View in Genome Browser
Species Human (GRCh38)
Location 7:66624369-66624391
Sequence AGGCACTGTCGGTTTCACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026009279_1026009282 -7 Left 1026009279 7:66624369-66624391 CCTACGTGAAACCGACAGTGCCT No data
Right 1026009282 7:66624385-66624407 AGTGCCTACTGATGTCCCCAGGG No data
1026009279_1026009281 -8 Left 1026009279 7:66624369-66624391 CCTACGTGAAACCGACAGTGCCT No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data
1026009279_1026009283 -6 Left 1026009279 7:66624369-66624391 CCTACGTGAAACCGACAGTGCCT No data
Right 1026009283 7:66624386-66624408 GTGCCTACTGATGTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026009279 Original CRISPR AGGCACTGTCGGTTTCACGT AGG (reversed) Intergenic
No off target data available for this crispr