ID: 1026009281

View in Genome Browser
Species Human (GRCh38)
Location 7:66624384-66624406
Sequence CAGTGCCTACTGATGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026009278_1026009281 24 Left 1026009278 7:66624337-66624359 CCAGAGTTTTCTCTTGAACTTCA No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data
1026009276_1026009281 29 Left 1026009276 7:66624332-66624354 CCAACCCAGAGTTTTCTCTTGAA No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data
1026009279_1026009281 -8 Left 1026009279 7:66624369-66624391 CCTACGTGAAACCGACAGTGCCT No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data
1026009277_1026009281 25 Left 1026009277 7:66624336-66624358 CCCAGAGTTTTCTCTTGAACTTC No data
Right 1026009281 7:66624384-66624406 CAGTGCCTACTGATGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026009281 Original CRISPR CAGTGCCTACTGATGTCCCC AGG Intergenic
No off target data available for this crispr