ID: 1026009799

View in Genome Browser
Species Human (GRCh38)
Location 7:66628266-66628288
Sequence CGGGACACACAGATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026009799_1026009808 -1 Left 1026009799 7:66628266-66628288 CCTGTCTCCATCTGTGTGTCCCG No data
Right 1026009808 7:66628288-66628310 GGTGGAAAAACGGTCACGGTGGG No data
1026009799_1026009807 -2 Left 1026009799 7:66628266-66628288 CCTGTCTCCATCTGTGTGTCCCG No data
Right 1026009807 7:66628287-66628309 CGGTGGAAAAACGGTCACGGTGG No data
1026009799_1026009809 0 Left 1026009799 7:66628266-66628288 CCTGTCTCCATCTGTGTGTCCCG No data
Right 1026009809 7:66628289-66628311 GTGGAAAAACGGTCACGGTGGGG No data
1026009799_1026009804 -5 Left 1026009799 7:66628266-66628288 CCTGTCTCCATCTGTGTGTCCCG No data
Right 1026009804 7:66628284-66628306 TCCCGGTGGAAAAACGGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026009799 Original CRISPR CGGGACACACAGATGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr