ID: 1026011188

View in Genome Browser
Species Human (GRCh38)
Location 7:66637725-66637747
Sequence CACTTCCCAGTTAATCCCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026011188_1026011191 -5 Left 1026011188 7:66637725-66637747 CCGTAGGGATTAACTGGGAAGTG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 1026011191 7:66637743-66637765 AAGTGGCATGAGGAACCTTAAGG 0: 1
1: 1
2: 1
3: 25
4: 239
1026011188_1026011195 28 Left 1026011188 7:66637725-66637747 CCGTAGGGATTAACTGGGAAGTG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 1026011195 7:66637776-66637798 TTTCATCTTGATCTAGGTGATGG 0: 1
1: 1
2: 3
3: 24
4: 243
1026011188_1026011192 0 Left 1026011188 7:66637725-66637747 CCGTAGGGATTAACTGGGAAGTG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 1026011192 7:66637748-66637770 GCATGAGGAACCTTAAGGAATGG No data
1026011188_1026011194 22 Left 1026011188 7:66637725-66637747 CCGTAGGGATTAACTGGGAAGTG 0: 2
1: 0
2: 0
3: 5
4: 94
Right 1026011194 7:66637770-66637792 GAAATGTTTCATCTTGATCTAGG 0: 1
1: 1
2: 0
3: 28
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026011188 Original CRISPR CACTTCCCAGTTAATCCCTA CGG (reversed) Intronic
900529307 1:3144925-3144947 CACCTCCCAGTGAACCCCCAGGG + Intronic
903735889 1:25529833-25529855 CTCTTCTCAGTTATTCCCTGGGG - Intergenic
907603789 1:55795333-55795355 CAATTCCCAGTTTCTCCCTTGGG + Intergenic
907994879 1:59619981-59620003 CACTTCACACTTAATCCATCAGG - Intronic
909039630 1:70633326-70633348 CACTTCCCAATTAATCCTTTGGG - Intergenic
914390012 1:147212463-147212485 CTCTTTCCAGTGAATCCCTCTGG + Exonic
917215236 1:172671366-172671388 GGCTTCCCAGTGAATCCCAAAGG - Intergenic
919085174 1:192912389-192912411 CACTTTCCACTTCATGCCTAAGG + Intergenic
919293085 1:195659186-195659208 CACTTCCCAGGGACTTCCTAGGG - Intergenic
920659990 1:207907574-207907596 TACTTCCCAATTAAGCCCAAAGG + Intronic
921740650 1:218680937-218680959 CACTTCATACTTAATCCATAAGG - Intergenic
1063999300 10:11650035-11650057 CTCTTCACAGTAAATTCCTATGG - Intergenic
1067529846 10:47062132-47062154 CCCTTCCCAGTTAATCCTACGGG + Intergenic
1078069540 11:8099179-8099201 CATTTCCCAGATCATCCCTCTGG + Intronic
1083246995 11:61436356-61436378 CACCTCCCAGCTTCTCCCTAGGG - Intronic
1083502385 11:63122191-63122213 CACATCCAAGTAAATCCCCATGG - Intronic
1088176782 11:107061671-107061693 CTTTTCCAAGTTAATTCCTAAGG - Intergenic
1090243100 11:125197706-125197728 GACTTTCCAGCTAACCCCTACGG - Intronic
1091008202 11:131973459-131973481 CACTCCACAGTGAATCCCTAAGG + Intronic
1092826551 12:12405057-12405079 CTCTTCCCAGTTACTCAGTAAGG - Intronic
1094303131 12:28988533-28988555 CACTTCCTAATTAATCTCTGAGG + Intergenic
1100791016 12:98130086-98130108 CACTTCCTTGTTCATCCATAAGG + Intergenic
1111109648 13:83690050-83690072 CACTTCCCTGTTATTTTCTACGG + Intergenic
1114579782 14:23747052-23747074 CAGTTCCCACATACTCCCTATGG - Intergenic
1116147695 14:41096796-41096818 CACTTTCCTATTAATCCATAGGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118107443 14:62676085-62676107 CAGTTTCCAGTTTATCCTTATGG + Intergenic
1122199948 14:100116438-100116460 CAGTTTCCAGTTAGTCTCTATGG - Intronic
1125447296 15:39771839-39771861 CAATATCCAGTTAATCCTTAAGG + Intronic
1125875090 15:43137080-43137102 CATTTCCCTGTTCATGCCTATGG - Intronic
1125935378 15:43630951-43630973 GACTTCCCACTTATTCTCTAGGG - Intronic
1132082409 15:98878224-98878246 CAGTCCCCAGTTTGTCCCTACGG + Intronic
1132535195 16:475590-475612 CACTTCCCAATTCAGCCCTGCGG - Intronic
1134336622 16:13305642-13305664 CACTTCCAGGTTAATGCCTGTGG - Intergenic
1137752401 16:50876527-50876549 CAGTTCCCTGTTAATTCCTTTGG + Intergenic
1143334316 17:6160886-6160908 AACTGACCAGATAATCCCTAAGG + Intergenic
1148506088 17:48128126-48128148 CACTTCCCAGTTTACACCTGCGG + Intergenic
1151523103 17:74645198-74645220 AACCTCCCACTTAATCCCCAAGG + Intergenic
1157450118 18:47779988-47780010 CACTTCCCAGGGAATCAATATGG - Intergenic
1158383318 18:56959953-56959975 CACTTCCCAAGTATTCACTATGG - Intronic
1163115547 19:15186972-15186994 CACTTCGCAGTTCACACCTAGGG + Exonic
1167171343 19:47834358-47834380 CACTTACCAGTTACTCACCATGG - Intronic
1167485706 19:49761859-49761881 CAGTTCCCAGTTAGTTCCTCTGG + Intronic
1168171910 19:54595040-54595062 CACCTCCCACTTCATCCCCAGGG - Intronic
927466614 2:23341503-23341525 CAGTTCCCACCTCATCCCTAGGG + Intergenic
930420177 2:51141397-51141419 CACTTTCCATTTAATCTCCAGGG - Intergenic
930824844 2:55686372-55686394 CCCTTCCCAGTTTATGCCTTTGG - Exonic
932171685 2:69563320-69563342 CACTTCTCAGATAATCACTTTGG - Intronic
933904246 2:86874040-86874062 CATTTACCAGGTAATCCATAGGG - Intergenic
935336184 2:102019284-102019306 CTCTTCCCAGATACTTCCTAAGG + Intronic
936705747 2:115071612-115071634 CACTTCTGAGTTCCTCCCTAGGG - Intronic
936740325 2:115498054-115498076 GATTTCCCAGTTACTCCCTGAGG - Intronic
936952817 2:117995166-117995188 CCCTTCCTAGTTTATCCCAATGG - Intronic
940372933 2:152922801-152922823 CACTGTCTAGTCAATCCCTAAGG - Intergenic
944660627 2:201918687-201918709 CACGTCCCAGTTCTTCCCTCAGG - Intergenic
1169622464 20:7523389-7523411 CCCTTCCCAGTTAAACCTTGGGG - Intergenic
1173772921 20:45679195-45679217 CACTTCCCAGTTTAGTCCTGAGG + Intergenic
1175199560 20:57267882-57267904 CCCTTCCCAGTTCATCCCAAAGG - Intergenic
1178347615 21:31845210-31845232 CACTTCCCAGTCCATCACAATGG - Intergenic
1178407514 21:32336731-32336753 CACTTCCCCTGAAATCCCTATGG + Intronic
1181585906 22:23853702-23853724 CACTTCCCACTTATTTCTTAAGG + Intergenic
1182401506 22:30081022-30081044 GATTTGCCAATTAATCCCTATGG + Intronic
1183299996 22:37054199-37054221 AGCTTGCCTGTTAATCCCTAGGG + Intronic
949431710 3:3984031-3984053 CCCTTCCCAGTTTATGCCTTTGG - Intronic
951535780 3:23739279-23739301 CACTTCCCAGTCAATGCTAAAGG - Intergenic
958956144 3:100467456-100467478 TACTTCCCAGTGAATACCCAGGG - Intergenic
963640529 3:147856797-147856819 CACTTTCCAGTGAATCCATCTGG - Intergenic
965484359 3:169260413-169260435 CATTTTCCAGTTATTCTCTAAGG + Intronic
976956438 4:90906634-90906656 CCCTGCCCACTTAATCACTATGG - Intronic
982169160 4:152644428-152644450 CACTTCCCAGTTCATCTAAAAGG + Exonic
986267770 5:6205100-6205122 CAGTTCCCAGTCAATCCACATGG + Intergenic
991988092 5:72310081-72310103 CAATCCCAAGTTCATCCCTATGG - Intronic
995556712 5:113337256-113337278 AGCTTCCCAGTGAATCCCTCTGG + Intronic
997835906 5:137193330-137193352 AACGTCCCAGTCAATCCCCAAGG - Intronic
1002456451 5:179347876-179347898 AACTTCACAGTTAAACCCTCAGG + Intergenic
1005228808 6:23674832-23674854 CACTTCTCTGAAAATCCCTAAGG + Intergenic
1005389276 6:25316970-25316992 AACTTCCCAGTTAAAAACTAAGG - Intronic
1008573806 6:52839679-52839701 CACTTCCCAGGAAAACCCTCAGG + Intronic
1010365013 6:75040769-75040791 CAGATCCCAGTTCCTCCCTAGGG + Intergenic
1017170071 6:151448558-151448580 AACTTCTCAGTAAATCCCAAGGG + Intronic
1019076529 6:169392947-169392969 CACTTCCCAGTGAATGCCCAGGG + Intergenic
1022050343 7:26662365-26662387 TGTTTCCCAGATAATCCCTAAGG + Intergenic
1022154900 7:27650371-27650393 CACTTGCCATTTAAAGCCTATGG - Intronic
1024785936 7:52908010-52908032 CACTTCCAAGTTAATTCAGATGG + Intergenic
1026011188 7:66637725-66637747 CACTTCCCAGTTAATCCCTACGG - Intronic
1026016448 7:66674791-66674813 CACTTCCCAGTTAATCCCTACGG - Intronic
1031135002 7:117874198-117874220 CACTTCTCAGTTAGTCCTTCAGG - Intergenic
1034679277 7:152916100-152916122 CACTTTTCAGTTACTCCCTGGGG - Intergenic
1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG + Intergenic
1035448693 7:158960184-158960206 CACTTCCAAGTGATTCCCCAAGG - Intergenic
1035642483 8:1194481-1194503 CACTTTCCAGGTCATCCCCAGGG + Intergenic
1038755787 8:30339708-30339730 CACTTCTTAGCTAATCCCTTGGG + Intergenic
1039953183 8:42187917-42187939 CACTTCCCAGCAAATCCTTCGGG + Exonic
1040293260 8:46136252-46136274 AACGTCCCCGTGAATCCCTACGG + Intergenic
1045396685 8:101767783-101767805 CATTCCCCAGTTAATCCATGAGG - Intronic
1049915018 9:309108-309130 CACTTGCCAGTTATACCCTACGG + Intronic
1055278738 9:74649535-74649557 GACTGTACAGTTAATCCCTAGGG + Intronic
1055715351 9:79111335-79111357 CTCTTTCCAGTTTATCCCCAAGG - Intergenic
1058577954 9:106423567-106423589 CCCTTCCCAATTAATCTGTAAGG - Intergenic
1187033200 X:15509764-15509786 CACTTCCCTGTAAATGCCTTGGG - Intronic
1200228232 X:154431191-154431213 CCCTTCCCAGTTAGGCCCTGAGG - Intronic