ID: 1026012924

View in Genome Browser
Species Human (GRCh38)
Location 7:66650971-66650993
Sequence CACAGGGACATGCCGAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026012924_1026012933 10 Left 1026012924 7:66650971-66650993 CCGAGCCTCGGCATGTCCCTGTG 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1026012933 7:66651004-66651026 GGGCCTGGTTCTGCACTGTCAGG No data
1026012924_1026012927 -10 Left 1026012924 7:66650971-66650993 CCGAGCCTCGGCATGTCCCTGTG 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1026012927 7:66650984-66651006 TGTCCCTGTGCTGAAGCCCAGGG 0: 1
1: 0
2: 4
3: 30
4: 278
1026012924_1026012930 -5 Left 1026012924 7:66650971-66650993 CCGAGCCTCGGCATGTCCCTGTG 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1026012930 7:66650989-66651011 CTGTGCTGAAGCCCAGGGCCTGG 0: 1
1: 0
2: 5
3: 75
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026012924 Original CRISPR CACAGGGACATGCCGAGGCT CGG (reversed) Intronic
900366155 1:2312774-2312796 CACAGGGACACCCCCAGGCCAGG + Intergenic
900653313 1:3742029-3742051 CACTGAGACATCCTGAGGCTTGG - Intergenic
900892175 1:5457523-5457545 CACTGGGTCATGCCCAGGCCCGG - Intergenic
901439271 1:9267685-9267707 CACAGGGACATCTCCAGGTTTGG - Exonic
902824770 1:18965489-18965511 CACATGGAGACGCTGAGGCTTGG + Intergenic
906062566 1:42958257-42958279 CACCGGGAGGGGCCGAGGCTGGG + Intronic
906700958 1:47857641-47857663 CCCAGGGCCCTGCCCAGGCTGGG + Intronic
908487982 1:64614176-64614198 CACAGGGAGATGCCCAGCCAGGG - Intronic
912372523 1:109184969-109184991 CACAGGGCCATGAAGAGGCCAGG + Intronic
921049669 1:211502013-211502035 CACAGGGAGGTGCCCAGCCTCGG - Intergenic
921817264 1:219577915-219577937 CACAGGGATATGCACAGGGTGGG - Intergenic
922751755 1:228073395-228073417 CACAGGAACATGCAGAGGGTGGG - Intergenic
922796559 1:228342426-228342448 GACACGGAGATGCCGAGGCTTGG + Intronic
923541416 1:234890948-234890970 CACAGGGACAGACCCAGCCTGGG - Intergenic
1064436172 10:15313069-15313091 CACAGGGAGATGCAGAGCCCAGG - Intronic
1064436371 10:15314587-15314609 CACAGGGAAATGCAGAGCCCAGG - Intronic
1064705658 10:18070005-18070027 GACAGGGAGGTGCAGAGGCTGGG - Intergenic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1070219624 10:74426947-74426969 CACAGGGGCCTGTTGAGGCTTGG - Intronic
1075573172 10:123559643-123559665 CCCAGAGACATGCAGAGACTTGG + Intergenic
1076025705 10:127111132-127111154 AACAGGGACATCCCAAGTCTGGG - Intronic
1077236739 11:1485545-1485567 CCCAGGGACAGGCAGAGGCACGG + Intronic
1077491861 11:2864602-2864624 CACAGTGACATGCCGTGGGCTGG + Intergenic
1080023589 11:27590506-27590528 TAGAGGGACATGGCTAGGCTTGG + Intergenic
1083878053 11:65535086-65535108 GACAGGGCCAGGCCCAGGCTGGG + Intronic
1084491034 11:69478396-69478418 CCCAGGGACTTGCAGAGGCTTGG - Intergenic
1085517466 11:77119720-77119742 CACCGGGCCCTGCAGAGGCTGGG + Intronic
1090823851 11:130369508-130369530 CACAGGGACATGTCCATTCTAGG + Intergenic
1091182819 11:133622197-133622219 CACAGGGACATGACCAGATTTGG - Intergenic
1091577580 12:1752929-1752951 CCCAGGTACATGCCCAGGTTTGG + Intronic
1091669084 12:2439453-2439475 CACAGGCACATGTCTTGGCTGGG + Intronic
1091835353 12:3582007-3582029 CACAGGGACCTCCTGAGGCCTGG - Intronic
1092074451 12:5661617-5661639 CACTGTGACAGGCAGAGGCTGGG + Intronic
1101822532 12:108195184-108195206 TACAGGGAAATGCAGAGGCCCGG - Intronic
1102716285 12:114975819-114975841 CACAGGGACAGACAGAAGCTGGG - Intergenic
1105838380 13:24230899-24230921 CAGAGGGACATTCCGTGGCTGGG + Intronic
1108272424 13:48774654-48774676 CAGAGGGAGATGATGAGGCTTGG - Intergenic
1110821877 13:79926194-79926216 CACAGAGCCATGCAGATGCTCGG - Intergenic
1112387966 13:98957937-98957959 CACAGGCACAGGCACAGGCTGGG + Intronic
1112763883 13:102720128-102720150 CACAGGGTAATGCTGAGGCCTGG + Intergenic
1118308803 14:64677569-64677591 CACAGGGACCTACAGAGGATCGG - Intergenic
1118812596 14:69286088-69286110 CACAGTGAGTTGCCCAGGCTGGG - Intronic
1119467051 14:74866433-74866455 CACAGGGACATGAAGAGGCTGGG + Intronic
1122772849 14:104104941-104104963 CACAAGGACAGGCGGAGCCTGGG - Intronic
1122868095 14:104618618-104618640 CTCAGGGAGATGCAGAAGCTTGG + Intergenic
1124721125 15:32111517-32111539 CTCGGGGACATGCAGAGGGTTGG + Intronic
1125957403 15:43799943-43799965 CCCAGGGAGGTGCCGGGGCTGGG + Exonic
1127960702 15:63888307-63888329 CCCAGGGCCAGGCTGAGGCTGGG - Intergenic
1129208395 15:74051043-74051065 CACAGGCACAGGCTGAGCCTGGG + Intergenic
1129378943 15:75153663-75153685 CCCAGGGACCTGCCCAGCCTTGG - Intergenic
1131768873 15:95712827-95712849 CACAGGGAAATGGGGAGGATGGG - Intergenic
1132624638 16:886328-886350 GCCAGGGACAAGCCGTGGCTGGG - Intronic
1133027410 16:2994844-2994866 CAGAGGGACAGGCCGGGGCAGGG - Intergenic
1134111572 16:11518374-11518396 CACAGGGAGAATCCCAGGCTTGG + Intronic
1135544957 16:23359405-23359427 CACTGGGACCTGCCGAGGGCTGG - Intronic
1135844578 16:25907344-25907366 GACAGGGACATGGGGAGGCGGGG + Intronic
1138551770 16:57752465-57752487 CCCAGGGACATGTGGAGGCCAGG + Intronic
1139146288 16:64329402-64329424 CACAGGGAAAGGCTGAGACTTGG + Intergenic
1140748943 16:78006009-78006031 CACAGGGTCATTCCTAGACTGGG - Intergenic
1141274416 16:82573624-82573646 CACAGGTTCAGGCTGAGGCTGGG - Intergenic
1141385281 16:83616893-83616915 CACAAAGACATGCCAAAGCTTGG - Intronic
1141668080 16:85476327-85476349 TGCAGGCACCTGCCGAGGCTGGG + Intergenic
1141986846 16:87585695-87585717 CACATGGACATGCTGGGGGTCGG + Intergenic
1142711740 17:1727261-1727283 CACAGGGACATGCAGGCGCTGGG + Exonic
1144695965 17:17303910-17303932 CAGAGGGCCACCCCGAGGCTGGG - Intronic
1144947670 17:18978130-18978152 CACAGGGACTGTCCGGGGCTTGG + Exonic
1150858206 17:68773598-68773620 CACAGGGACCTGGCGGGGTTGGG + Intergenic
1152642250 17:81454157-81454179 CACATGGAGAAGCCAAGGCTTGG - Intronic
1153434758 18:5057607-5057629 CACAGGGACAGGCGGAAGGTCGG - Intergenic
1157215527 18:45780175-45780197 CAGAGGGACATGGCCAGGCACGG + Intergenic
1157584337 18:48791528-48791550 CCCAGGGCCAGGCTGAGGCTGGG - Intronic
1160016133 18:75141991-75142013 CACGGGGGCATGCAGAGGCAAGG - Intergenic
1160843226 19:1155669-1155691 CAGAGGAACATACCGAGGCTTGG - Intronic
1160861104 19:1237552-1237574 CACAGGGAGAAACTGAGGCTGGG + Intronic
1161086539 19:2338135-2338157 CACAGGGACATGCCGACTGCTGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1162238731 19:9329889-9329911 AACAGGGAGATGCCAAGGTTAGG - Intronic
1162496845 19:11028115-11028137 CACTGGGACAGGCCGTGGATTGG + Intronic
1165088113 19:33365362-33365384 CACAGGCACACGCCCATGCTCGG + Intergenic
1165494775 19:36146063-36146085 GGCAGGGACATGCTGGGGCTGGG + Intronic
1166937446 19:46343025-46343047 CACAGGCACATGCACAGGCACGG + Exonic
1167097508 19:47382196-47382218 CACAGGGCTAAGCCCAGGCTGGG - Exonic
1168137771 19:54362921-54362943 CACAGGGACAGGATGTGGCTGGG + Intronic
1168160251 19:54505703-54505725 CACAGGGACAGGATGTGGCTGGG - Intronic
1168711465 19:58502882-58502904 GACAGTGACATGCAGAGGCAGGG + Intronic
925032469 2:661439-661461 CACCCGGAGCTGCCGAGGCTGGG + Intergenic
927152054 2:20201876-20201898 CTCAGGGCCATGCTGAGGCCTGG - Exonic
930730391 2:54723495-54723517 CACAGGGACAGGCAGAGGGAGGG + Intronic
932490215 2:72115506-72115528 GACAGGGAGGGGCCGAGGCTGGG + Intergenic
933140179 2:78782882-78782904 CAGAGAGACATGCTGAGGCTAGG + Intergenic
937418656 2:121737215-121737237 CGCAGGGGCGTGCCGAGGCGCGG + Intronic
942124772 2:172812513-172812535 CACAAGGAAATACAGAGGCTGGG - Intronic
944491267 2:200260071-200260093 CACAGGGACAGCACGATGCTGGG - Intergenic
944831288 2:203535609-203535631 CACAGGGACTTGCGGAGGAAAGG - Intergenic
947729078 2:232418320-232418342 GACAGGGACAGGCCTAGCCTAGG + Intergenic
948496420 2:238352581-238352603 CACAGGGACGTGGGGAAGCTGGG + Intronic
948542836 2:238702505-238702527 GACAGGGACAGGGCGAAGCTGGG + Intergenic
948598041 2:239092990-239093012 AAAAGGGACATGCCGAGGGCTGG + Intronic
948681802 2:239640209-239640231 CACAGGACCAGGCTGAGGCTGGG - Intergenic
948864791 2:240769725-240769747 CACAGTGAGCTGCCGGGGCTAGG + Intronic
1168763002 20:362529-362551 CTCTGGGACATGGCAAGGCTGGG - Intergenic
1169300318 20:4436565-4436587 GACAGGGTCAGGCCAAGGCTGGG + Intergenic
1170927750 20:20741359-20741381 CACAGCTACATGCAGAGGCTGGG - Intergenic
1171009323 20:21499785-21499807 CAGAAGGACAGGCCCAGGCTAGG - Intergenic
1172022845 20:31926397-31926419 CACAGTGTCCTGGCGAGGCTGGG + Intronic
1172618416 20:36305335-36305357 CACAGGGAAAGGCAGAGGCTGGG + Intergenic
1172864245 20:38083481-38083503 CATAGGGACATGCGGAAGCAAGG - Intronic
1175524866 20:59626651-59626673 CCCAGGGAGGTGCCGAGGCCTGG + Intronic
1175685448 20:61024800-61024822 CACAGGGACATGCAGGCCCTCGG + Intergenic
1179629290 21:42666664-42666686 GACACAGACATGCAGAGGCTCGG - Intronic
1180841472 22:18960832-18960854 CTCAGGGACATGGCCAGGCCTGG - Intergenic
1181060019 22:20277962-20277984 CTCAGGGACATGGCCAGGCCTGG + Intronic
1181172752 22:21019034-21019056 CCCAGGGACATCCCCAGGCAAGG - Intronic
1181647816 22:24243321-24243343 CTCAGGGACAAGTCGGGGCTGGG - Intronic
1182474420 22:30568778-30568800 AAGAGGGACATGCAGAGGCCTGG + Intronic
1183300053 22:37054446-37054468 CACAGGGCTATCCGGAGGCTAGG + Intronic
1184093476 22:42304347-42304369 CACAGGGAGGTGGGGAGGCTGGG + Intronic
1184564554 22:45284463-45284485 CACAGGTACAAGCCAAGGCCCGG - Intergenic
1185130503 22:49036013-49036035 CACAGGGCCAGGCTCAGGCTCGG + Intergenic
1185276874 22:49953683-49953705 CAGAGGGACCTGCTGAGGCCTGG - Intergenic
1185301049 22:50081470-50081492 CACAGGGCCACACCAAGGCTAGG + Intronic
950675428 3:14551464-14551486 AACAGGGACATACAGAGGATGGG + Intergenic
950682638 3:14595644-14595666 CACAGGGCCACACCAAGGCTGGG - Intergenic
953209898 3:40866544-40866566 CACAGGGAAAAGACGAGGGTAGG + Intergenic
960053933 3:113263118-113263140 CACAGGGACAAGTTGAGGCTTGG + Intronic
966316485 3:178652303-178652325 CACTGGGACCTGTCGAGGTTGGG + Intronic
966333774 3:178845197-178845219 CACAGGGGGATTCTGAGGCTTGG + Intergenic
968377451 4:54819-54841 CACAGGTACAGGCCGAGGCAGGG - Intronic
968504077 4:963984-964006 CACAGGGGCCGGCCGTGGCTGGG + Intronic
968584790 4:1411191-1411213 CACAGGGTCAGGCCGGGGCAGGG + Intergenic
968632387 4:1658759-1658781 CACAGGGCCCTGCAGAGGATGGG + Intronic
968900078 4:3426777-3426799 CCCAGGGACAGGCAGAGGCGTGG + Intronic
968934335 4:3602094-3602116 CACAGGGACTTGCTGAGGCCTGG - Intergenic
969666665 4:8561262-8561284 CACAGGAAAGTGCCTAGGCTGGG + Intronic
970536725 4:17037647-17037669 CATAGGCACATGCAGAGACTGGG + Intergenic
972102632 4:35442022-35442044 CACAGGTACATGTCAAGCCTAGG + Intergenic
977566910 4:98589838-98589860 CACAGAGACATTCCCATGCTAGG - Intronic
986312762 5:6566895-6566917 AACATGGACATGCTGAAGCTTGG - Intergenic
988051055 5:26031596-26031618 TGCAGGGAGATGCCGAGGGTTGG - Intergenic
989429899 5:41340629-41340651 CCCAGGGACAGGCCAAGGCAAGG + Intronic
992445851 5:76832878-76832900 CACAGGGCCATGCCGTTACTTGG - Exonic
994330661 5:98502046-98502068 CCCATGGACATGCCCAGGCCAGG - Intergenic
996410242 5:123151210-123151232 CACAGGGATATGCCAGGGTTGGG + Intronic
997242587 5:132318725-132318747 CAAAGGGACATGACCTGGCTAGG - Intronic
1000713821 5:164614682-164614704 CACAGGAACATGCAGGGACTAGG - Intergenic
1002439858 5:179258682-179258704 CACAGGGACCTTCCCAGGCCCGG + Intronic
1006056557 6:31389522-31389544 CACAGGGTGATCCAGAGGCTCGG - Intergenic
1006069282 6:31486501-31486523 CACAGGGTGATCCAGAGGCTCGG - Intergenic
1006600057 6:35219360-35219382 CAGGGGGACATGTCTAGGCTAGG - Intronic
1009673498 6:66787728-66787750 TCCAGGGACATGAGGAGGCTGGG - Intergenic
1017730610 6:157312343-157312365 CACTGGGACATGATGAGGCTAGG - Intronic
1019623697 7:2004619-2004641 CCCAGGGTCCTGCCGAGGCCAGG + Intronic
1020215696 7:6188474-6188496 CCCAGGGAGAAGCTGAGGCTCGG + Intronic
1021001788 7:15340628-15340650 CACATGGAGCTGCCAAGGCTTGG - Intronic
1024492025 7:49996414-49996436 CACAGGGACATTTTGAGTCTTGG + Intronic
1026012924 7:66650971-66650993 CACAGGGACATGCCGAGGCTCGG - Intronic
1026982694 7:74536035-74536057 CACAAGGACAGGCAGAGGCCAGG + Intronic
1028646839 7:93108148-93108170 CACAGGCGCATGGCGAGGCACGG - Intronic
1028805244 7:95018728-95018750 CACAGGGAAATGCAGAAGCAAGG - Intronic
1029535557 7:101155290-101155312 TTCATGGACATGCCCAGGCTTGG - Intronic
1029657138 7:101934746-101934768 GACAGTGCCATGCCAAGGCTGGG + Intronic
1034997299 7:155586239-155586261 AACAAGCACATGCCCAGGCTGGG - Intergenic
1035640906 8:1184602-1184624 CCCAGGCAGATGCCGAGCCTGGG + Intergenic
1037305293 8:17497497-17497519 CACAGGGACCGGACGAGGCGAGG - Intronic
1037813378 8:22099417-22099439 CTTAGGGACAGGACGAGGCTGGG - Intronic
1039041462 8:33412470-33412492 CACAGGGAAATGCTGAGGCCTGG + Intronic
1040775667 8:51040088-51040110 CACAGGTAGAGGCCGTGGCTTGG + Intergenic
1041424574 8:57705914-57705936 CACAGGCAGATTCGGAGGCTTGG - Intergenic
1041550105 8:59090939-59090961 CATAGGGACCTACTGAGGCTGGG - Intronic
1047274477 8:123395593-123395615 CAAAGGGTTATGACGAGGCTTGG + Intronic
1049450550 8:142659248-142659270 CCCAGGGACATGCCTTGGCTTGG + Intronic
1050192848 9:3046588-3046610 CACAGGCAGATGCAGAGGCCAGG - Intergenic
1053113777 9:35484473-35484495 CACAGGGATATGTTGGGGCTAGG - Intergenic
1054455818 9:65429887-65429909 CACAGGGACTTGCTGAGGCCTGG + Intergenic
1056744014 9:89284237-89284259 CACATGGACATTAAGAGGCTAGG + Intergenic
1057709919 9:97430550-97430572 CACATGGGAATGCAGAGGCTCGG - Intronic
1058736695 9:107900237-107900259 CACAGTGCCATGTCAAGGCTTGG + Intergenic
1059340270 9:113594101-113594123 CCCAGGCACAAGCCGGGGCTGGG - Intronic
1059394935 9:114028315-114028337 GGCAGGGACATGCCGGGGCTGGG - Intronic
1059419313 9:114181152-114181174 CAGAGGGAGAGACCGAGGCTGGG + Intronic
1061185040 9:129048180-129048202 CACAGGGCCAGGCCGAGGAGAGG - Intronic
1061479258 9:130888530-130888552 CACAGGGACAAAACCAGGCTGGG + Intergenic
1061654619 9:132079488-132079510 CTGAGGGACAGGCAGAGGCTTGG + Intronic
1062095080 9:134698926-134698948 AACAGGGACATGCCAAGGAAGGG - Intronic
1062519979 9:136953744-136953766 CACAGTGAACTGCCCAGGCTGGG - Exonic
1203571784 Un_KI270744v1:139427-139449 CACAGGTACAGGCCGAGGCAGGG + Intergenic
1187667403 X:21628588-21628610 CACAGGAAGCTGCCAAGGCTTGG + Intronic
1192115142 X:68403130-68403152 CACAGGGACATTTGGCGGCTAGG - Intronic
1193472623 X:81925697-81925719 CAGAGGAACATGGCAAGGCTTGG - Intergenic
1195399171 X:104443635-104443657 AACAGAGACATGGAGAGGCTAGG - Intergenic
1198554788 X:137781756-137781778 TACAGGCACATGCCTAGGCAGGG - Intergenic
1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG + Intergenic