ID: 1026013802

View in Genome Browser
Species Human (GRCh38)
Location 7:66656500-66656522
Sequence TTTTTAGCTGGGTCCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026013802 Original CRISPR TTTTTAGCTGGGTCCCTGTG TGG Intronic
900652372 1:3736138-3736160 TTTTTAGCTGTGTTTCAGTGGGG + Exonic
901125283 1:6924560-6924582 TTCTGATCTGGGTCCCTGTGAGG + Intronic
903750786 1:25619023-25619045 TCTTGAGCTGGTTCCCTGTAGGG + Intronic
904986477 1:34553633-34553655 TTTTTTGCTGGGTCTCTGCCAGG - Intergenic
905326162 1:37153373-37153395 TTGTTCTCTGGGTCCCTGAGTGG + Intergenic
909516612 1:76514978-76515000 TTTTTTGTTGTGTCCTTGTGTGG + Intronic
910374814 1:86556648-86556670 TTTTTTGTTGGGTCTCTGTCAGG + Intronic
910456445 1:87402603-87402625 TTTTTAGATGGGTCCTTATGAGG + Intergenic
916428016 1:164700157-164700179 CTTTTCGCTGGGTCCCTCTGTGG + Intronic
917406213 1:174711009-174711031 GCTTTAGCTGCCTCCCTGTGGGG - Intronic
917559464 1:176132191-176132213 TGTTTACTTGGATCCCTGTGTGG - Intronic
917899927 1:179531781-179531803 TTTTTAGCTTGGTCCTCCTGGGG - Intronic
921779828 1:219149601-219149623 TTTTTACCTGGCTCTCTCTGGGG + Intergenic
924822767 1:247509965-247509987 TTTTTTGTTGTGTCTCTGTGAGG + Intronic
1063144406 10:3283749-3283771 TTTTTATTTGGGTTCCTGTGTGG - Intergenic
1063870536 10:10412238-10412260 TTTTCAGCTGGGTCCCTCCATGG + Intergenic
1064477737 10:15708874-15708896 CATGAAGCTGGGTCCCTGTGTGG + Intronic
1066143500 10:32531519-32531541 TTTTTTGCTGTGTCTCTGTCTGG + Intronic
1069168368 10:65193034-65193056 TTTTTTTCTGGCTCCCAGTGAGG + Intergenic
1069720834 10:70548472-70548494 TTTTGGCCTGGGTCTCTGTGTGG + Intronic
1070144638 10:73764928-73764950 TTTCTATCTGGGTCCCATTGGGG + Intronic
1070159483 10:73857331-73857353 TTGTTATCTGGGTCCCTTCGTGG - Intronic
1071522037 10:86337432-86337454 GTTGTAGCTGGGGCCCAGTGTGG - Intronic
1076990744 11:272259-272281 TTTCTCTCTGGGTCTCTGTGGGG + Intergenic
1077368326 11:2170287-2170309 TTGTTCACTGGGGCCCTGTGGGG - Intronic
1077895170 11:6448589-6448611 GTTTTTGCTGGGTTCTTGTGGGG - Intergenic
1080898917 11:36469225-36469247 TTGTCAGCTGGGTCCCTGGTAGG + Intergenic
1082164417 11:48928686-48928708 TTTTTTGTTGTGTCTCTGTGCGG - Intergenic
1086294687 11:85351872-85351894 TTTTTTGTTGCGTCCCTGTCAGG + Intronic
1086311939 11:85545451-85545473 TTTTTTGTTGTGTCTCTGTGAGG + Intronic
1087058619 11:93957151-93957173 GCTTTAGCTGGGTGCCTGTCAGG + Intergenic
1087307203 11:96501379-96501401 TGTTTAGCTTGGTCCCTTTTTGG - Intronic
1089088686 11:115847240-115847262 TTTTCAGTTGGGCCCCTGTTCGG - Intergenic
1090931395 11:131300917-131300939 TGTATAGCTGGTTCCCAGTGAGG - Intergenic
1094753949 12:33444202-33444224 TTTTTTTCTGGGTCTCTCTGGGG + Intergenic
1096489256 12:52004883-52004905 CCTTTTGCTGGGTCCCTTTGGGG + Intergenic
1096547549 12:52351034-52351056 TTTCTAGCTGGGTCCCTTCAGGG + Intergenic
1097634875 12:62110441-62110463 TTTTTTCTTGGGTCTCTGTGAGG + Intronic
1097785688 12:63756461-63756483 GTTTCAGCTGGTTCCCTGTTAGG + Intergenic
1100414751 12:94359807-94359829 TTTTTTGTTGTGTCCCTGTCTGG - Intronic
1100467900 12:94864297-94864319 TTTTTTGCTGGGTCCTTGTCTGG - Intergenic
1101406794 12:104435869-104435891 TTCTGAGCTGGGTCTCTGGGTGG - Intergenic
1101839582 12:108318507-108318529 TTGTTTGCAGGGTCACTGTGGGG + Intronic
1103155768 12:118683675-118683697 TTCTCAGCTGGGTTGCTGTGAGG + Intergenic
1103206872 12:119136721-119136743 TATCTAACTGGGTCCCGGTGGGG + Intronic
1103493814 12:121345318-121345340 TTTTCTGCTGGGTCCCTGACTGG - Intronic
1104170566 12:126276192-126276214 TTTTTACCTGAATACCTGTGAGG + Intergenic
1104182294 12:126393665-126393687 TCTTGAGCTGTGTCCCTGGGCGG - Intergenic
1105467802 13:20662481-20662503 TTTTTTGTTGTGTCTCTGTGTGG - Intronic
1107881628 13:44837146-44837168 TTTCTAGCTGTGTCCCTGCATGG + Intergenic
1109105444 13:58244077-58244099 TTTTTTGCTGGGTCTCTGCCAGG - Intergenic
1113768158 13:112893833-112893855 ATCCCAGCTGGGTCCCTGTGGGG + Intergenic
1117491329 14:56250792-56250814 TTGTTCGGTGGGTGCCTGTGAGG - Intronic
1118160216 14:63281120-63281142 TTTTAACCTGGGTCCCTATGAGG - Exonic
1118521879 14:66595375-66595397 TTTCTAGCTGGGAACCTCTGTGG + Intronic
1120771032 14:88380559-88380581 TTTTAAGCTCCATCCCTGTGAGG - Intergenic
1120941344 14:89953238-89953260 TTTTTAGCCAGGTTCCTGTCTGG - Intronic
1121266264 14:92604317-92604339 CTTTGAGCTGGGTCCCTGACAGG - Intronic
1202842535 14_GL000009v2_random:135612-135634 TTTTTTGTTGTGTCCCTGCGAGG + Intergenic
1124046199 15:26152478-26152500 TTTTTTGTTGTGTCTCTGTGAGG + Intergenic
1124211442 15:27768116-27768138 TTTCTAGGTGGATGCCTGTGAGG + Intronic
1126318526 15:47396808-47396830 TTTTGCACTGGGCCCCTGTGAGG - Intronic
1130134238 15:81168626-81168648 TTTTGAGCTGGGTGCCTGGACGG + Intronic
1132369271 15:101282433-101282455 TTTCTAACTGTGTGCCTGTGTGG - Intronic
1137359284 16:47798108-47798130 CCTTTAGCTGGGCACCTGTGAGG + Intergenic
1137450214 16:48566542-48566564 TTTTTAGTTGGATCTCTTTGTGG + Intronic
1137591073 16:49694290-49694312 TTTTTAGAGGGGTCTCTGTATGG - Intronic
1138395148 16:56698353-56698375 TTTTTTGATGGGTTCCTGTAGGG - Intronic
1145208958 17:20999216-20999238 TTTGTAGCAAGCTCCCTGTGTGG - Intergenic
1146040493 17:29449059-29449081 TTTCTAGCTGGGTCCATGATCGG - Intronic
1149085107 17:52707473-52707495 TAATTAGCTGGATCCATGTGAGG + Intergenic
1149139390 17:53412085-53412107 TTTTTTGCTGTGTCTCTGTCAGG + Intergenic
1149298773 17:55285127-55285149 CATTTGCCTGGGTCCCTGTGGGG + Intronic
1150212248 17:63447550-63447572 GTTTAAGCTTGGTCCCTCTGAGG - Intergenic
1150241722 17:63639379-63639401 TTTAAAGGGGGGTCCCTGTGGGG + Intronic
1150908262 17:69361680-69361702 ATTGGAGCTGGGTCCCTCTGAGG - Intergenic
1152007698 17:77692914-77692936 TCTTAAGTTGGGTCCCTGTTGGG - Intergenic
1153591147 18:6675146-6675168 CTCTTAGCTGAGTCCCTCTGTGG - Intergenic
1155977685 18:32148822-32148844 TTTTTTGCTGTGTCCTTGTCTGG + Intronic
1157097518 18:44699810-44699832 TTTTTAGCTGACGCCCTGTGAGG - Intronic
1162402309 19:10453605-10453627 TGTTTGCCTGGGTCACTGTGTGG + Intronic
1165869624 19:38962089-38962111 TTTTTAACAGCGTCCCTGGGTGG - Intronic
1166149235 19:40859501-40859523 TTTGTAGCTGTGTAACTGTGGGG + Intronic
1166940324 19:46359425-46359447 TTTTTAGCTGGCTCCCTAATTGG - Intronic
1202656302 1_KI270708v1_random:25881-25903 TTTATTGTTGTGTCCCTGTGAGG - Intergenic
927865159 2:26583420-26583442 TGTTGAGATGGGTCCCTCTGAGG + Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928606058 2:32946515-32946537 CGTTTAGGTGGCTCCCTGTGGGG - Intergenic
928880746 2:36093462-36093484 TTTTTTGTTGTGTCTCTGTGAGG - Intergenic
930926119 2:56820119-56820141 TTTTTTGTTGTGTCTCTGTGAGG - Intergenic
931186220 2:59954008-59954030 TGTCTAGCTTGGTCCATGTGTGG + Intergenic
931340808 2:61399041-61399063 TTTTTAGCTGTGCCCATGTTAGG - Intronic
931682020 2:64758870-64758892 CTTTTAGCTGGGACACTTTGAGG + Intergenic
935964337 2:108458389-108458411 TTTTTTGCTGTGTCCTTGTCTGG + Intronic
936490649 2:112969152-112969174 TTTATAGGTTGGTCACTGTGGGG + Intergenic
937154104 2:119706340-119706362 TTTGTTGCTGGTTTCCTGTGGGG + Intergenic
937501155 2:122480654-122480676 CATTTGGCTGGGTCCTTGTGAGG - Intergenic
939260320 2:139799687-139799709 TTCTTAGTTGCGTGCCTGTGGGG + Intergenic
939766929 2:146262504-146262526 TTTTGATCAGGGTCCTTGTGGGG + Intergenic
943301194 2:186203082-186203104 TTTTCAGTTGTGTCCCTGTCTGG - Intergenic
1168984915 20:2039718-2039740 AGTTTAGGTGGGTCCCTGTTAGG - Intergenic
1169405615 20:5318589-5318611 TTTTGAGTTGTGTCCCGGTGTGG + Intergenic
1170410531 20:16085455-16085477 TTTTTTGTTGGGTCCATGTCTGG - Intergenic
1172714071 20:36950428-36950450 TTGTTAGGTGGGGCCCTGTTTGG - Intronic
1176631284 21:9140521-9140543 TTTTTTGTTGTGTCCCTGCGAGG + Intergenic
1180375303 22:12087077-12087099 TTTTTTGTTGTGTCCCTGTGAGG - Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1183336786 22:37253155-37253177 TCTTTAGCTGGGTGAATGTGTGG - Intergenic
1183609683 22:38891240-38891262 TATTCTGCTGGGTCCTTGTGAGG + Intergenic
1184390033 22:44198452-44198474 TTTTTACCTGCAACCCTGTGAGG + Intronic
951769665 3:26241524-26241546 TTTTTGGTTGTGTCTCTGTGTGG + Intergenic
952533936 3:34290579-34290601 ATTTTTGCTGGGTAACTGTGTGG + Intergenic
952865448 3:37852405-37852427 GTTTGAGCTGAGTTCCTGTGAGG + Intergenic
953112567 3:39957207-39957229 TTTTTTGGTGTGTCCCTGTCAGG - Intronic
954491107 3:50906226-50906248 TTTTTTGCTGTGTCTCTGTCAGG + Intronic
956068515 3:65422438-65422460 TTTTTAGCTGTGTGACTGGGGGG + Intronic
957019775 3:75112553-75112575 TTTCCAGCTGGTTCCCTGTTAGG + Intergenic
959828658 3:110833314-110833336 TTTTTTGTTGTGTCTCTGTGAGG + Intergenic
961122799 3:124387264-124387286 TTTATAGCTGAGTTCCAGTGAGG - Intronic
961151901 3:124645995-124646017 TTTTTTGCTGCCTCCCTGTCTGG + Intronic
963614965 3:147525141-147525163 TTTTTTGTTGTGTCTCTGTGAGG + Intergenic
964456391 3:156871896-156871918 TTTTTAGTTGTGTCCTTGTCTGG + Intronic
965327875 3:167330405-167330427 TTTTTAGCTGGGAGCCTATATGG + Intronic
965841895 3:172915708-172915730 TTTTTGCCTGGGTCTGTGTGTGG + Intronic
967100607 3:186212351-186212373 ATTTTAGCTGGGTTAGTGTGGGG - Intronic
968408503 4:364154-364176 TTTTTTGTTGTGTCTCTGTGAGG + Intronic
970075973 4:12221126-12221148 TAATTAGCTGGGTACCTTTGGGG + Intergenic
973312111 4:48720836-48720858 GTTTAAACTGTGTCCCTGTGTGG - Intronic
975732125 4:77347669-77347691 TTCTCTGCTGTGTCCCTGTGAGG - Intronic
977199008 4:94093250-94093272 TTTTTTGTTGTGTCCCTGTCTGG + Intergenic
978064277 4:104377210-104377232 TTTTTTGTTGTGTCTCTGTGAGG - Intergenic
978952588 4:114579036-114579058 TTTTTTGCTGGGTCTCTGCCAGG + Intergenic
980109935 4:128625599-128625621 TTTTCATTTGGGTCCCTTTGTGG - Intergenic
982925377 4:161330910-161330932 TTCTTCACTGGGTCACTGTGTGG + Intergenic
1202756900 4_GL000008v2_random:72519-72541 TTTTTTGTTGTGTCCCTGTGAGG - Intergenic
985986950 5:3523788-3523810 TTTTCAGCAGAGTCCCTCTGAGG - Intergenic
988646244 5:33098362-33098384 TTTTTAGTTGTGTCTCTGTCAGG + Intergenic
988976639 5:36522613-36522635 TCCTTGGCTGGGTCCCAGTGAGG - Intergenic
991171888 5:63637036-63637058 ATTTTAGCTGGGTGCCTATGTGG + Intergenic
991534202 5:67648725-67648747 CTTTTAGCTGGGTCCCTGCATGG + Intergenic
993578598 5:89632388-89632410 TTTTTTGCTGTGTCTCTGTCAGG + Intergenic
993986650 5:94605443-94605465 TTTTTTGCTGTGTCTCTGTCAGG - Intronic
995455864 5:112351642-112351664 TTTGTTGCTGGGTCCTTGTCTGG - Intronic
996215268 5:120858365-120858387 TTTTTATCTGTTTCCCTATGAGG - Intergenic
997343582 5:133167668-133167690 TTTTTTGTTGTGTCTCTGTGAGG + Intergenic
999652102 5:153777749-153777771 TTTTTAGCATGTTCTCTGTGGGG - Intronic
1000237324 5:159374170-159374192 TTTTTTGCTGTGTCCTTGTCTGG + Intergenic
1001823715 5:174729319-174729341 TTTTGACCTGGGTCTCTGTGAGG - Exonic
1004483448 6:16042792-16042814 TTTTTAGCTGCTTGCATGTGCGG - Intergenic
1007382034 6:41496493-41496515 GGTTTAGCTGGGGCCATGTGAGG + Intergenic
1007658385 6:43466934-43466956 TCTCTAACAGGGTCCCTGTGAGG + Intergenic
1008155844 6:48013037-48013059 TTTTTGGCTGGGTCTCTGCCAGG + Intronic
1009997846 6:70916861-70916883 TTTTTTGTTGTGTCTCTGTGAGG + Intronic
1010957738 6:82109511-82109533 TTTTTTGTTGGGTCCTTGTCTGG - Intergenic
1011393754 6:86883388-86883410 TTTTTTGCTGTGTCTCTGTCAGG + Intergenic
1011483494 6:87818534-87818556 TTTTCAGATGTGTCCCTGTTTGG + Intergenic
1013840753 6:114390314-114390336 TTTTTCTCTGCGTCTCTGTGTGG - Intergenic
1014747890 6:125221259-125221281 TCTTTAGCTGGGTCTGTCTGTGG + Intronic
1015197720 6:130542268-130542290 TTTTTGGTTGTGTCTCTGTGAGG - Intergenic
1016642773 6:146368810-146368832 TTTTTTGTTGTGTCCTTGTGTGG + Intronic
1019292220 7:256394-256416 TTTTTTGCAGAGTCTCTGTGGGG - Intronic
1021758437 7:23878826-23878848 TTTTTACCTGGGTAACTGTGTGG + Intergenic
1022346731 7:29523616-29523638 TTTTTTGTTGTGTCCCTGTCCGG - Intergenic
1023161044 7:37296128-37296150 CTTTTAGCTGGGTGTCTGTGAGG + Intronic
1026004478 7:66590353-66590375 TTTTTAGCTGGGTCCTTTTATGG - Intergenic
1026013802 7:66656500-66656522 TTTTTAGCTGGGTCCCTGTGTGG + Intronic
1026017769 7:66684124-66684146 TTTTTAGCTGGGTCCTTATGTGG + Intronic
1026025860 7:66742988-66743010 TTTTTAGCTGGGTCCTTGTGTGG + Intronic
1028224983 7:88239733-88239755 TTTTTAGCTGGTCCACTTTGTGG + Intergenic
1032362273 7:131267016-131267038 TTCTTAGAAGAGTCCCTGTGAGG - Intronic
1037205800 8:16319062-16319084 TTTTTAGATATGACCCTGTGAGG - Intronic
1043006900 8:74831105-74831127 CCTTTGGCTGGCTCCCTGTGGGG - Intronic
1043052701 8:75403750-75403772 TTTTTATCTGGGTCAATGTGGGG + Intergenic
1046121008 8:109847287-109847309 TTTTTAGTTGTGTTCCTGTCTGG + Intergenic
1047675476 8:127197024-127197046 TTGTTAGCTGGGCCCCTGGGAGG + Intergenic
1049922456 9:378144-378166 AATTTAGCTGTGTCCCTTTGAGG - Intronic
1050132620 9:2428419-2428441 TTTTTAGCTGGGTGGATGGGTGG - Intergenic
1050474316 9:6023981-6024003 TTCATAGCTGGGTCACTGTTAGG + Intergenic
1050928236 9:11293193-11293215 TTTTTTGGTGGGTCTCTGCGAGG + Intergenic
1051496343 9:17727739-17727761 AATTCTGCTGGGTCCCTGTGAGG - Intronic
1051919608 9:22249976-22249998 TTTTTAGCTGTGTCCTTGCCAGG + Intergenic
1056274161 9:84976270-84976292 CTTCTTGCTGTGTCCCTGTGTGG + Intronic
1056679203 9:88702338-88702360 CTCTTATCTAGGTCCCTGTGTGG + Intergenic
1058395278 9:104545312-104545334 ATTTTAGCTGGGGGCCAGTGGGG + Intergenic
1058409654 9:104717572-104717594 TTTTTGGTTGTGTCTCTGTGAGG - Intergenic
1059075750 9:111192183-111192205 TTTTTTTCTGGGTATCTGTGAGG - Intergenic
1059665746 9:116445009-116445031 TTTCTAGATGGGTCCATATGTGG - Intronic
1060020974 9:120130863-120130885 TATATATCTGGGTTCCTGTGTGG + Intergenic
1060235865 9:121862284-121862306 TTTCTAGCTGTGTGACTGTGGGG + Intronic
1060925996 9:127455510-127455532 TTTTTAGCTTGTTCTCTGAGTGG - Intronic
1061602365 9:131679649-131679671 AGTTTAGCTGGGTCCCTGAAAGG + Intronic
1203754111 Un_GL000218v1:108135-108157 TTTTTTGTTGTGTCCCTGCGAGG + Intergenic
1203537691 Un_KI270743v1:57380-57402 TTTTTTGTTGTGTCCCTGTGAGG - Intergenic
1187393441 X:18900971-18900993 TGTTGAGCTGTGGCCCTGTGCGG + Intronic
1189684076 X:43545573-43545595 TTTAAAGATGGCTCCCTGTGAGG - Intergenic
1191647303 X:63495768-63495790 TTTTTGGCTGCGTCCCTGCCAGG - Intergenic
1192669093 X:73120454-73120476 TTTTTTGCTGTGTCTCTGTCAGG - Intergenic
1193230952 X:79045666-79045688 TTTTCAGCTTGGTCGCTGTTTGG - Intergenic
1193638982 X:83988298-83988320 TTTTTTGTTGGGTCCCTGCCAGG - Intergenic
1199033887 X:143030104-143030126 TTTTAAGATGGGCCCATGTGAGG + Intronic
1200009276 X:153109074-153109096 TGTCCAGCTGGGTCACTGTGTGG - Intergenic
1200030324 X:153290848-153290870 TGTCCAGCTGGGTCACTGTGTGG + Intergenic