ID: 1026020008

View in Genome Browser
Species Human (GRCh38)
Location 7:66698941-66698963
Sequence CTCCGGTGACTGCAGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026020004_1026020008 -3 Left 1026020004 7:66698921-66698943 CCTTGGCTGGTCACAAGTAACTC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG 0: 1
1: 0
2: 3
3: 31
4: 202
1026019999_1026020008 15 Left 1026019999 7:66698903-66698925 CCATGGTGTGCTCTTTCCCCTTG 0: 1
1: 1
2: 2
3: 25
4: 257
Right 1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG 0: 1
1: 0
2: 3
3: 31
4: 202
1026020002_1026020008 -1 Left 1026020002 7:66698919-66698941 CCCCTTGGCTGGTCACAAGTAAC 0: 1
1: 0
2: 1
3: 1
4: 80
Right 1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG 0: 1
1: 0
2: 3
3: 31
4: 202
1026020003_1026020008 -2 Left 1026020003 7:66698920-66698942 CCCTTGGCTGGTCACAAGTAACT 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG 0: 1
1: 0
2: 3
3: 31
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026020008 Original CRISPR CTCCGGTGACTGCAGGGCCA AGG Intronic
900405425 1:2490866-2490888 CTCAGGAGATGGCAGGGCCAGGG - Intronic
901020613 1:6253488-6253510 ATCCGGCAACTGCAGGGCCCAGG - Intronic
901935215 1:12621868-12621890 CTCCGGTGACTGCAGTCTCTTGG - Intergenic
903281952 1:22255134-22255156 CTCCGTTGCCTGCAGGGACTAGG - Intergenic
904314620 1:29652181-29652203 CTCCTGTGAGCGCAGGGCCAGGG + Intergenic
906537339 1:46558792-46558814 CTGCTGTTCCTGCAGGGCCAGGG + Exonic
914373397 1:147050843-147050865 CGGCGGTGACCGCAGGGCTAAGG - Intergenic
915484548 1:156211219-156211241 CTCCTGAGACTGAAGGGACAGGG - Exonic
915931564 1:160063548-160063570 CTCAGGTGAGCCCAGGGCCAGGG - Intronic
918320798 1:183362431-183362453 CGTCAGGGACTGCAGGGCCAGGG - Intronic
920767699 1:208849411-208849433 ATTTGGTGACTGCAAGGCCATGG + Intergenic
920805703 1:209231801-209231823 CTCAGGTGACCGCGGGGCCGGGG + Intergenic
921159853 1:212465083-212465105 TGCAGGTGACTGCAGGGCCTGGG + Intergenic
922875512 1:228937090-228937112 CTGGGCTGCCTGCAGGGCCAAGG - Intergenic
923021611 1:230168438-230168460 CTCCGGGGACAGGAGGGGCAAGG - Intronic
1063117543 10:3082506-3082528 CGCCGGTGACTGCAGGGCTCTGG - Intronic
1064129391 10:12695479-12695501 ATGCGGTGGCTACAGGGCCAGGG - Intronic
1064152786 10:12878784-12878806 CCCTGGTGACTTTAGGGCCAAGG - Intergenic
1064408942 10:15088708-15088730 CCCGGGTACCTGCAGGGCCATGG + Exonic
1069942257 10:71964081-71964103 CCCCGGGGACTGGAGGGCCGAGG + Intergenic
1070356015 10:75640965-75640987 CACCTGTGATTGCAGGGCCCTGG + Intronic
1073106205 10:101033454-101033476 CTCCAGTGGCTGCAGGTCCCTGG + Intronic
1073514360 10:104063810-104063832 CTCCGAAGACTGCAGGGGCAAGG + Exonic
1074397347 10:113108687-113108709 TTCCGGCCTCTGCAGGGCCAGGG + Intronic
1075327721 10:121547886-121547908 CTCCAGTGACTCCAGGACCTGGG + Intronic
1075551452 10:123395638-123395660 CTCCAGGGACTGCAGGGAGAAGG - Intergenic
1076054854 10:127364120-127364142 CCCCAGTGTCTGCAGGACCATGG + Intronic
1076364078 10:129910916-129910938 CACAGGTGCCAGCAGGGCCATGG + Intronic
1076445468 10:130510966-130510988 CTCATGTGAGTGCTGGGCCAGGG + Intergenic
1076992231 11:281460-281482 CTGCGGTGGGTGCAGGGACAGGG + Exonic
1077029618 11:459061-459083 CTCCGGTGAATGTAGGACCTGGG + Intronic
1077297763 11:1834141-1834163 CTACGGTGACCCCAGGCCCAGGG - Intronic
1078352726 11:10607818-10607840 CTCCGCTGACTTCATGGCCATGG - Intronic
1080616303 11:33947569-33947591 CTCTGGTGACTGAAGGGGCCTGG - Intergenic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1084084722 11:66849785-66849807 CTCCAGTGCCTGCAGATCCAGGG + Exonic
1084179750 11:67440401-67440423 GTCCAGTTCCTGCAGGGCCATGG + Exonic
1086953126 11:92910698-92910720 CTCCAGTGCCTGCTGGTCCAGGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089387044 11:118075197-118075219 CTCAGGTGACCTCAGGGTCAGGG - Intergenic
1090471986 11:126989025-126989047 GTCGGGGGACAGCAGGGCCAAGG + Intronic
1092967811 12:13661652-13661674 CTCCAGTGTCTGCAGGGGCTAGG + Intronic
1094338934 12:29389400-29389422 CTCCGGTATCTGCAGGGCAGAGG - Intergenic
1096603992 12:52752063-52752085 CTCAGGTGGCAGCAGAGCCAAGG + Intergenic
1096994900 12:55832329-55832351 CTTCAGTGAGGGCAGGGCCAAGG + Intergenic
1104299571 12:127552014-127552036 CTCCTGTGAATGCAGGGTCACGG + Intergenic
1105255893 13:18743947-18743969 GACCGGTGTCTGCAGAGCCAGGG - Intergenic
1105415644 13:20209052-20209074 CTCCTGTGGCTGAAGGGGCAAGG - Intergenic
1105522893 13:21147236-21147258 CTTCTGCGACTGCAGGGTCATGG - Exonic
1105846382 13:24297745-24297767 CACAGGTGCCTGCAGAGCCAAGG - Intronic
1106890927 13:34244547-34244569 CACAGGTGCCTGCAGGGGCATGG - Intergenic
1108844433 13:54660346-54660368 CTTCTGAGACTGCAGGGGCAAGG + Intergenic
1112487915 13:99836281-99836303 CTCCCCTGTATGCAGGGCCAGGG - Intronic
1113231217 13:108215579-108215601 GCCCGGTGACTGCAAGGCCCCGG - Intronic
1113339093 13:109404590-109404612 CTCCTGAGACTGCAGGGACATGG - Intergenic
1113794935 13:113051334-113051356 CTCCGGTGGTCCCAGGGCCACGG + Intronic
1113847546 13:113401312-113401334 CTCCCAGGACTGCAGGGGCAGGG + Intergenic
1113928417 13:113953598-113953620 CTCCTGTGTCTGCAGAGCCATGG + Intergenic
1120906069 14:89622436-89622458 CTCAGGTGACTGTAGGCCCTGGG + Intergenic
1121249276 14:92487789-92487811 GTCAGGTGTCAGCAGGGCCATGG + Intronic
1121874695 14:97440612-97440634 CTATGATGACTGCAAGGCCACGG - Intergenic
1122165397 14:99819610-99819632 TTCCCGTCACCGCAGGGCCAAGG - Intronic
1122599500 14:102914357-102914379 CACCTGTGGCTGCAGGGTCAAGG - Intergenic
1122959833 14:105089396-105089418 CTCAGGTGACAGCAGAGCCCAGG + Intergenic
1125584073 15:40807882-40807904 CCCCGAGGGCTGCAGGGCCAGGG + Intronic
1125727459 15:41875342-41875364 CTCCAGAGGCTGCAGAGCCAGGG + Intronic
1126141908 15:45445878-45445900 CTCTGCTGATTACAGGGCCATGG - Intronic
1127547345 15:60003744-60003766 CTCCGGGGACTGGGGGGCAAGGG + Intergenic
1129319047 15:74763693-74763715 CTCCTGTGCCCTCAGGGCCAAGG + Intergenic
1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG + Intronic
1129711787 15:77824111-77824133 CTCTGCTCACTGCAGGGCCAAGG - Intergenic
1132405816 15:101541405-101541427 CACAGGTGACTGCACTGCCATGG - Intergenic
1132415017 15:101613446-101613468 CACCAGTGACTGCTGGGCCAGGG - Intergenic
1132501266 16:285792-285814 CTGCGGGGCCTGCAGGGGCAGGG - Intronic
1132577535 16:670911-670933 CTCCAGGGCCTGCGGGGCCAGGG - Exonic
1135007168 16:18836031-18836053 CTTCGGATACTGCAGGGCCACGG + Exonic
1136333089 16:29594775-29594797 CTCCGGTGGGTGGAGGGCCTAGG + Intergenic
1136447785 16:30334863-30334885 CTCCGGTGGGTGGAGGGCCTAGG + Intergenic
1136580865 16:31150032-31150054 CTCCGCTGACTCTAGCGCCATGG - Exonic
1136615692 16:31397318-31397340 CTCCTGTGGCTGCAGTGACATGG + Intronic
1136628595 16:31476633-31476655 CTCCGGAGTCCTCAGGGCCATGG + Intronic
1137067422 16:35863110-35863132 CTGTGGTGGCTGCAGTGCCATGG + Intergenic
1138125831 16:54437687-54437709 CTCCGGTGAATGCCTGCCCATGG - Intergenic
1139954662 16:70687303-70687325 CTCAGGTGAGTGCAGGGACCAGG + Intergenic
1142176321 16:88647052-88647074 CTCCGGGGGCTGCGGGGCCCAGG - Intronic
1142302845 16:89268729-89268751 CTCAGCTGCCAGCAGGGCCAAGG + Intronic
1144515906 17:15917553-15917575 CTCCAGTGCCTGCGGGGGCAGGG - Intergenic
1144779056 17:17798824-17798846 CTCCGGTGACAGCATGGGGAGGG - Intronic
1146943582 17:36859893-36859915 CTCCCCTGACTGCTGGGCCCTGG - Intergenic
1148324721 17:46776650-46776672 CTCCAGTGATTGCAGGGCTGTGG - Intronic
1152656781 17:81523563-81523585 CTCACCTGGCTGCAGGGCCAAGG + Intronic
1152751155 17:82063042-82063064 CTCCGCTGTCTGCAGGGCCCTGG - Intronic
1153636656 18:7118130-7118152 GCCCGGGGACTGCAGGGCCGCGG - Intergenic
1154402669 18:14056555-14056577 CTGTGGTGGCTGCAGTGCCATGG + Intergenic
1154435138 18:14336742-14336764 GACCGGTGTCTGCAGAGCCAGGG + Intergenic
1157813150 18:50711961-50711983 CTCAGCTGACAGCAGGGCCCTGG + Intronic
1158629054 18:59096226-59096248 CTCTGCAGACTGCAAGGCCAAGG + Intergenic
1158782994 18:60674500-60674522 CTCCTGTGCATGCAGGTCCACGG - Intergenic
1160349650 18:78165648-78165670 CTCTGGAGCCTGCAGGCCCATGG + Intergenic
1160363438 18:78304008-78304030 CTCCAGTGCCTGCTGGGCCATGG - Intergenic
1160397432 18:78582810-78582832 CTCCACTGACTTCAGGGCAAAGG + Intergenic
1160853708 19:1206519-1206541 CTCCGGGGACCTCAGGCCCACGG - Exonic
1160914097 19:1488491-1488513 CGCGGGTGACTGCAGGTCCCCGG + Intronic
1161010092 19:1955729-1955751 CTCCGGTGACAGCAGTGGCACGG - Intronic
1161127184 19:2564720-2564742 CTCCAGAGACTCCAGGGGCAGGG - Intronic
1163077724 19:14909856-14909878 CTCAGGTGACCTCAGGTCCATGG - Intergenic
1163595166 19:18217050-18217072 CTTCCCTGACTGCAGGGCTAGGG + Intronic
1163607293 19:18282028-18282050 CTCCGGGGACTGGAGGGGGATGG + Intergenic
1163695580 19:18761752-18761774 CTTTGGTGCCAGCAGGGCCAGGG + Intronic
1167255552 19:48425930-48425952 CTATGGTGACTGGAGGGGCAGGG - Intronic
1167664831 19:50818033-50818055 CTCCGGTGAGGGCGGGGCCTCGG + Intergenic
1168486080 19:56763182-56763204 CTCTGGTGACTACTGGGGCATGG + Intergenic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
927172200 2:20379519-20379541 CTCCTGGGGCTGTAGGGCCACGG + Intergenic
932245142 2:70190642-70190664 CTCCGTTGACTGCAGGGCCCCGG - Intronic
932656335 2:73613937-73613959 CTCAGCTGACTGCAGGGACAGGG - Intergenic
934490909 2:94761575-94761597 GACCGGTGTCTGCAGAGCCAGGG - Intergenic
936059025 2:109282548-109282570 CTCAGCTGACTGCAGGGCCTGGG + Intronic
936518577 2:113197971-113197993 CTCAGGTGTCAGCAGGGTCAGGG - Intronic
938278829 2:130050720-130050742 GACCGGTGTCTGCAGAGCCAGGG - Intergenic
938329804 2:130441581-130441603 GACCGGTGTCTGCAGAGCCAGGG - Intergenic
938360142 2:130679922-130679944 GACCGGTGTCTGCAGAGCCAGGG + Intergenic
938378544 2:130823980-130824002 AGGCGGGGACTGCAGGGCCAGGG - Intergenic
947187085 2:227465046-227465068 CTCCGGGCACCGCAGGGGCAGGG + Intergenic
948075675 2:235163642-235163664 CTGCGGTGTCTGCAGGGCACTGG - Intergenic
1169812684 20:9624666-9624688 CTCAGGAGACTCCAGAGCCAGGG - Intronic
1174414417 20:50357633-50357655 CTCTGCTGTCTGCAGGGCCTGGG - Intergenic
1175250713 20:57608830-57608852 CTCCAGTGCCTGAAGGCCCAGGG - Intronic
1175736652 20:61391880-61391902 CTCCGGGGCCTGCAGGGCTCTGG + Intronic
1175857251 20:62128622-62128644 ATACTGTGACTGCAGGGGCATGG - Intronic
1175968698 20:62673134-62673156 CTGCTGTGACTGCTGGGCCAGGG + Intronic
1175979077 20:62728004-62728026 CCACGGTGCCTGCAGGGCCAAGG + Intronic
1176000616 20:62829815-62829837 CAGCGGTGAGTGCAGGGACATGG + Exonic
1176010363 20:62890211-62890233 CTCTGGGGACTGCATGGCCACGG + Intronic
1176019901 20:62957235-62957257 CTCCTCTGCCTGCAGGGCCCTGG - Intronic
1176164209 20:63664389-63664411 CCCCGGTGGCTGCTGGGCCTGGG + Intronic
1178914462 21:36698981-36699003 CGCCTGTGACTCCAGGGCCGCGG + Intergenic
1179039007 21:37785059-37785081 CTCAGGTCACTGCAGAGCCTCGG + Intronic
1179198004 21:39183637-39183659 CTGCGGGGACTGCTGGCCCAGGG - Exonic
1180069262 21:45427966-45427988 CTCCCGGCTCTGCAGGGCCAGGG - Intronic
1180996847 22:19970152-19970174 CTCACGTGACTGCAGGGCTCTGG + Exonic
1183942226 22:41302232-41302254 CTCCGGGTGCTGCGGGGCCAAGG - Intronic
1184012965 22:41763217-41763239 CTCCTGTCGCTGCAGGACCAGGG + Exonic
1184233310 22:43169889-43169911 CTCCAGAAACTGCAGGGCCTGGG + Intronic
1184651153 22:45920037-45920059 CTGCGGGGACAGGAGGGCCATGG - Intergenic
1185347355 22:50316467-50316489 CACCAAAGACTGCAGGGCCACGG + Exonic
950270088 3:11606992-11607014 CTCCGGACACAGCATGGCCATGG + Intronic
950496976 3:13339719-13339741 CTGCAGTGACTGCAGACCCAGGG + Intronic
952875469 3:37941096-37941118 CTGCAGTGACACCAGGGCCAGGG + Intronic
953439567 3:42906225-42906247 CTCCGGTGGCTGCAGGGCGCAGG + Exonic
958675668 3:97265577-97265599 CTCCCGAGCCTGCAGGGGCAGGG + Intronic
961450973 3:127002167-127002189 CTGCACTGGCTGCAGGGCCATGG - Intronic
964452685 3:156826656-156826678 TTCCGGCCACTGCAGGTCCAGGG + Exonic
964623841 3:158740090-158740112 CACTGGTGAGTGCAGGGGCAAGG - Intronic
967016692 3:185488713-185488735 CTCCAGTGACTGCAGGCCAAGGG + Exonic
968232648 3:197012682-197012704 CCTCCCTGACTGCAGGGCCACGG + Intronic
968602745 4:1518064-1518086 CTCAGGTGGCTTCATGGCCAGGG - Intergenic
968763099 4:2452400-2452422 CACCGGGAGCTGCAGGGCCAGGG + Intronic
969173579 4:5383129-5383151 CACGGCTGACTGCAGGGCCCAGG - Intronic
969589028 4:8110754-8110776 GTCCGGGGGCTGCAGGGTCATGG + Intronic
969870112 4:10099204-10099226 CACAGGTCACTGCCGGGCCAGGG + Intronic
969900433 4:10344363-10344385 CTGCAGTGAATGCAGGACCATGG - Intergenic
974179044 4:58360839-58360861 CTTCTGAGACTGCAGGGGCAGGG + Intergenic
974603873 4:64123206-64123228 CCCCAGTGACTCCAGGGGCATGG - Intergenic
976111272 4:81676596-81676618 ATGCGGAGACTGCAGGGCCCAGG + Intronic
977494964 4:97763691-97763713 CTCCTGAGACTCCAGGCCCATGG + Intronic
982221779 4:153130727-153130749 CTGAGGTGACTGCAGGCTCATGG + Intergenic
985494872 5:198791-198813 ATCCGGCGTCTGCAGGGCCCAGG + Exonic
986085652 5:4442449-4442471 TTCCAGTGACTGCAGGGGCGGGG + Intergenic
986284486 5:6349369-6349391 CTCCGGGGACCACAGGGCGACGG - Intergenic
986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG + Intergenic
987989401 5:25190877-25190899 CTCCGGTGTCTGCAGGGCAGAGG + Intergenic
992221509 5:74578316-74578338 CTCCTGTCACTGCTGGGCAAGGG - Intergenic
996605014 5:125311646-125311668 CCCCAGTGACTGCAGCCCCAGGG + Intergenic
1002481750 5:179505979-179506001 ATCCGGTGTCTTCAGGGCCAAGG - Intergenic
1002924640 6:1598242-1598264 CTCAGATGCCTGCAGGGCCAAGG - Intergenic
1002939518 6:1703782-1703804 CACCAGTGGCCGCAGGGCCAAGG + Intronic
1004299411 6:14443781-14443803 CTCTGGTGACTGGAGGGCCATGG - Intergenic
1004401334 6:15291545-15291567 ATCCCTTCACTGCAGGGCCAAGG - Intronic
1005386927 6:25294250-25294272 CTCCTGAGACTCCAGGGCCCAGG - Intronic
1005512309 6:26521836-26521858 CTCCGGTATCTGCAGGGCAGAGG - Intergenic
1005864690 6:29928512-29928534 CTCCAGTGACTACAGCTCCAAGG - Intergenic
1008113567 6:47520501-47520523 CTCCGCTGACAGCAGGGGGAAGG + Intronic
1010407122 6:75518060-75518082 CTACTCTGACTGGAGGGCCACGG + Intergenic
1010519620 6:76817604-76817626 CTTCTGTGTCTGCAGGGGCAGGG - Intergenic
1011216062 6:85006933-85006955 CTCTGGTGACTCCAGGGACAGGG + Intergenic
1012647735 6:101709252-101709274 CTAAGGTTCCTGCAGGGCCACGG - Intronic
1016991566 6:149933209-149933231 CTCCTGTGCCTTCAGTGCCAAGG - Intergenic
1018092169 6:160354970-160354992 CTCCGGGGACTGCAGGAGGAAGG - Intronic
1019049776 6:169174016-169174038 CTCTGATGACTGCAGGGACGTGG - Intergenic
1019309353 7:352711-352733 CTCAGCTGAGTACAGGGCCAAGG - Intergenic
1019341744 7:511774-511796 CTCAGGGGGCTGGAGGGCCATGG + Intronic
1019730476 7:2627003-2627025 CTCCGGTGCCTGCAGGCCTTTGG + Intergenic
1020279510 7:6643169-6643191 GTCCGGGGACTCCAGTGCCATGG - Intronic
1022533834 7:31083698-31083720 CTCTGGTGACTGCAGGGTGTGGG - Intronic
1024256940 7:47546371-47546393 CTGCGGTGACGGCAGGTCCTGGG - Intronic
1025256064 7:57384582-57384604 CTCTGCTGTCTGCAGGGCCTGGG + Intergenic
1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG + Intronic
1027001632 7:74658155-74658177 CGCCGGGGCCTGCAGGGACAGGG + Intronic
1027050559 7:75018898-75018920 CTCTGGTGGGTGCAGGGCCTGGG - Intronic
1029382489 7:100222772-100222794 CTCTGGTGAGTGCAGGGCCTGGG + Intronic
1032389693 7:131547893-131547915 AGCAGGTGAGTGCAGGGCCAAGG - Intronic
1033142234 7:138838039-138838061 CACCGGGGACTGCAGGGCCCTGG - Exonic
1035203131 7:157279338-157279360 CTCTGGGGACTCCAGGGCCGCGG + Intergenic
1035337318 7:158138276-158138298 TCCAGGTGACTGCAGCGCCATGG - Exonic
1036815929 8:11902791-11902813 CTCTGGTGACTGCAAGGCCTGGG - Intergenic
1036847296 8:12178784-12178806 ACCCCCTGACTGCAGGGCCAAGG + Intergenic
1036868660 8:12421105-12421127 ACCCCCTGACTGCAGGGCCAAGG + Intergenic
1038489841 8:27962859-27962881 GTTCGGTGAGTGCAGGGCAAAGG - Intronic
1039547596 8:38421114-38421136 GGCTGGTGACTGCGGGGCCAGGG - Intronic
1040379692 8:46860539-46860561 GCCCTGTAACTGCAGGGCCAAGG - Intergenic
1043502897 8:80874116-80874138 CGCCGGTGGCCGCAGGGCCGGGG + Intronic
1046409864 8:113827626-113827648 CTTCTTTGACTGCTGGGCCAGGG - Intergenic
1048548084 8:135405322-135405344 CTCCAGTTCCTGCATGGCCAGGG - Intergenic
1048579047 8:135715949-135715971 CTCCTGTTTCTGCACGGCCAAGG + Intergenic
1048935766 8:139355419-139355441 CTCAGGTGACAGCCGGGCCCAGG + Intergenic
1048968569 8:139631060-139631082 CTCGGGCGACTGCAGGGACACGG + Intronic
1049853778 8:144849115-144849137 CTGCTGTTCCTGCAGGGCCAGGG + Intronic
1052881226 9:33601936-33601958 GACCGGTGTCTGCAGAGCCAGGG + Intergenic
1053495098 9:38543906-38543928 GACCGGTGTCTGCAGAGCCAGGG - Intronic
1054378233 9:64464141-64464163 GACCGGTGTCTGCAGAGCCAGGG + Intergenic
1057006464 9:91565230-91565252 CTTCCGTGACTGAAGGGCCATGG + Intronic
1057907309 9:98992841-98992863 CCCCAGTGCCTGCAGTGCCATGG - Intronic
1059726495 9:117013597-117013619 CTCAGGGGACTGCACGGGCACGG + Intronic
1060242771 9:121918559-121918581 CTCCAGGGACTGCAGGGCCAAGG + Intronic
1061074387 9:128332315-128332337 CTGGGGTGGCTTCAGGGCCAGGG + Intronic
1061940823 9:133882941-133882963 GTGCTGTGACTGCAGGGACAGGG + Intronic
1186250022 X:7655861-7655883 CTCCAGTGACTCCAGGCCCCAGG - Intergenic
1186415581 X:9380545-9380567 CCCCAGTGTCTGCAGTGCCAAGG - Intergenic
1187713259 X:22075512-22075534 CTATGGTGACTGCAGCACCAGGG - Intronic
1187950467 X:24465557-24465579 CTTCGGTGAGTACGGGGCCAAGG + Exonic
1188727862 X:33607368-33607390 CTCCTGAGCCTGCAGGGGCAGGG + Intergenic
1190325863 X:49206581-49206603 ATCCAGTGTCTGCAGCGCCAGGG - Exonic
1190922681 X:54870965-54870987 CTACAGTGACTTCAGGGTCAGGG + Intergenic
1199519698 X:148721750-148721772 CTGCGGTGATGGCAGGGCCATGG + Intronic
1199628879 X:149762478-149762500 TTGCGTTGACTGCAGGGACAAGG + Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic