ID: 1026023220

View in Genome Browser
Species Human (GRCh38)
Location 7:66726711-66726733
Sequence ATGGACTGCGAGGTCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026023214_1026023220 22 Left 1026023214 7:66726666-66726688 CCAAAAAGCAGAGGTTTTGTTTT No data
Right 1026023220 7:66726711-66726733 ATGGACTGCGAGGTCAGGTGCGG 0: 1
1: 0
2: 1
3: 7
4: 190
1026023213_1026023220 23 Left 1026023213 7:66726665-66726687 CCCAAAAAGCAGAGGTTTTGTTT 0: 1
1: 0
2: 2
3: 68
4: 542
Right 1026023220 7:66726711-66726733 ATGGACTGCGAGGTCAGGTGCGG 0: 1
1: 0
2: 1
3: 7
4: 190
1026023211_1026023220 28 Left 1026023211 7:66726660-66726682 CCCAGCCCAAAAAGCAGAGGTTT 0: 1
1: 1
2: 1
3: 25
4: 244
Right 1026023220 7:66726711-66726733 ATGGACTGCGAGGTCAGGTGCGG 0: 1
1: 0
2: 1
3: 7
4: 190
1026023212_1026023220 27 Left 1026023212 7:66726661-66726683 CCAGCCCAAAAAGCAGAGGTTTT No data
Right 1026023220 7:66726711-66726733 ATGGACTGCGAGGTCAGGTGCGG 0: 1
1: 0
2: 1
3: 7
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026023220 Original CRISPR ATGGACTGCGAGGTCAGGTG CGG Intronic