ID: 1026025557

View in Genome Browser
Species Human (GRCh38)
Location 7:66741132-66741154
Sequence CCGGCTCCCACCTTCCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026025543_1026025557 12 Left 1026025543 7:66741097-66741119 CCTGGCCGCCTCCCTCTCCGGCG 0: 1
1: 2
2: 1
3: 30
4: 373
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data
1026025545_1026025557 7 Left 1026025545 7:66741102-66741124 CCGCCTCCCTCTCCGGCGGCTCC 0: 1
1: 2
2: 6
3: 69
4: 787
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data
1026025546_1026025557 4 Left 1026025546 7:66741105-66741127 CCTCCCTCTCCGGCGGCTCCCCT 0: 1
1: 2
2: 1
3: 33
4: 404
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data
1026025547_1026025557 1 Left 1026025547 7:66741108-66741130 CCCTCTCCGGCGGCTCCCCTCGC 0: 1
1: 0
2: 4
3: 20
4: 189
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data
1026025548_1026025557 0 Left 1026025548 7:66741109-66741131 CCTCTCCGGCGGCTCCCCTCGCC 0: 1
1: 0
2: 4
3: 57
4: 288
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data
1026025550_1026025557 -5 Left 1026025550 7:66741114-66741136 CCGGCGGCTCCCCTCGCCCCGGC 0: 1
1: 0
2: 7
3: 52
4: 544
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data
1026025541_1026025557 29 Left 1026025541 7:66741080-66741102 CCTGACGCGGAGCATTTCCTGGC 0: 1
1: 1
2: 0
3: 3
4: 96
Right 1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026025557 Original CRISPR CCGGCTCCCACCTTCCGTCC AGG Intronic
No off target data available for this crispr