ID: 1026028046

View in Genome Browser
Species Human (GRCh38)
Location 7:66762892-66762914
Sequence TGCTGTGGCCCTTGCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026028046_1026028050 7 Left 1026028046 7:66762892-66762914 CCTGGACAGCAAGGGCCACAGCA 0: 1
1: 0
2: 8
3: 36
4: 315
Right 1026028050 7:66762922-66762944 CTTTGGAATAGCATGTGCAAAGG 0: 1
1: 0
2: 10
3: 34
4: 312
1026028046_1026028051 22 Left 1026028046 7:66762892-66762914 CCTGGACAGCAAGGGCCACAGCA 0: 1
1: 0
2: 8
3: 36
4: 315
Right 1026028051 7:66762937-66762959 TGCAAAGGCTCTCCCAACAAAGG No data
1026028046_1026028052 23 Left 1026028046 7:66762892-66762914 CCTGGACAGCAAGGGCCACAGCA 0: 1
1: 0
2: 8
3: 36
4: 315
Right 1026028052 7:66762938-66762960 GCAAAGGCTCTCCCAACAAAGGG No data
1026028046_1026028047 -10 Left 1026028046 7:66762892-66762914 CCTGGACAGCAAGGGCCACAGCA 0: 1
1: 0
2: 8
3: 36
4: 315
Right 1026028047 7:66762905-66762927 GGCCACAGCATTCCTCACTTTGG 0: 1
1: 0
2: 1
3: 16
4: 177
1026028046_1026028053 24 Left 1026028046 7:66762892-66762914 CCTGGACAGCAAGGGCCACAGCA 0: 1
1: 0
2: 8
3: 36
4: 315
Right 1026028053 7:66762939-66762961 CAAAGGCTCTCCCAACAAAGGGG 0: 2
1: 1
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026028046 Original CRISPR TGCTGTGGCCCTTGCTGTCC AGG (reversed) Intronic
900625017 1:3604032-3604054 TGGTGGAGCCCCTGCTGTCCCGG - Intronic
901057073 1:6453561-6453583 GGATGTGGCCCTGACTGTCCTGG + Intronic
902477296 1:16694932-16694954 GGATGTGGCCCTGACTGTCCTGG - Intergenic
902527163 1:17066658-17066680 TCCTGCAGCCCTTGCTGTTCTGG - Intergenic
902737488 1:18410781-18410803 TGCAGTTGCCCTTTCTGTCCTGG + Intergenic
902799671 1:18821390-18821412 TGCAGCGGGCCTTCCTGTCCAGG - Intergenic
903777978 1:25805405-25805427 TGATGTTGTCCCTGCTGTCCAGG + Intronic
903954740 1:27017536-27017558 CCCTGTTGCCCTGGCTGTCCAGG - Intergenic
904374076 1:30068758-30068780 TCCTGTGGCCCTGGCTGGCCTGG - Intergenic
904772690 1:32889225-32889247 TGATGTAGCCGTTGCCGTCCAGG - Exonic
905486396 1:38299909-38299931 GGCAGTGGCCCTACCTGTCCTGG - Intergenic
905933086 1:41803430-41803452 TTCTGTGGCCCTTGCAGTTGGGG - Intronic
906073094 1:43031773-43031795 TGCTATGGCCCTGACTGTGCTGG + Intergenic
906733462 1:48102802-48102824 AGCCGTGGGCCTTGCTCTCCTGG + Intergenic
907247625 1:53118030-53118052 TGCGGTGGCCCTGGCACTCCGGG - Intronic
907321540 1:53605836-53605858 TGCTGTGGGCCTGACTGTGCTGG - Intronic
907508248 1:54938024-54938046 TCCTCTGGCCCCTGCTGTTCTGG - Intergenic
912584352 1:110748870-110748892 AGCTGTGGCTCTTGCTCTCTTGG + Intergenic
914371082 1:147024898-147024920 TGCTGTGTCCCCTCCAGTCCGGG - Intergenic
915321028 1:155056600-155056622 TGATGTGGCCTTTGCTATCAGGG + Intronic
916659107 1:166904761-166904783 TGATCTGGCCCTGGCTGTCCTGG - Intergenic
916729133 1:167550938-167550960 TGATGTGCCCCTTTCTGTTCTGG - Intronic
919466505 1:197926659-197926681 AGCTGTGCCCCTGGCTGGCCTGG - Intronic
919790746 1:201289252-201289274 TGCTGTGGGCCTAGCTTTTCTGG + Intronic
919878036 1:201884837-201884859 TCCTGAGGCCCAGGCTGTCCTGG + Intergenic
920303294 1:205002696-205002718 TGCTGATGCCCTCGTTGTCCCGG - Exonic
921238840 1:213155385-213155407 TGCTGTAGCCCTTGTTGGCGAGG + Intronic
1063447113 10:6126298-6126320 CGCTGTGGACCTTGCTGAGCTGG + Intergenic
1063787014 10:9396165-9396187 TTCTGTAGCCCTTGCTACCCAGG - Intergenic
1064095746 10:12423388-12423410 TGCTGTGGTCCTTGTTGCCTAGG + Intronic
1065932416 10:30491405-30491427 GGCTGTGTCCCTTGCTTTCTGGG - Intergenic
1066005354 10:31141700-31141722 CACTGTGGCCACTGCTGTCCAGG + Intergenic
1069815283 10:71190084-71190106 TCCTGTGGCCCTTCCTGCCCTGG + Intergenic
1069906332 10:71734696-71734718 GGCTGTGGCCAGTGCTGGCCGGG + Intronic
1072632465 10:97155728-97155750 AGCTTTTGCCCTTGCTCTCCTGG - Intronic
1073048388 10:100653351-100653373 GACTGTGCCCCATGCTGTCCTGG + Intergenic
1073321851 10:102620429-102620451 TGCTGGGGCCCTGACTCTCCTGG - Intronic
1073380115 10:103071999-103072021 TGCTGTGGCTTATGCTTTCCTGG - Intronic
1075077244 10:119359596-119359618 TGCTGTGGCCCTGGCTGCTGTGG + Intronic
1075618678 10:123909971-123909993 GGCTGTGACCCTGGCAGTCCTGG - Intronic
1076265116 10:129103647-129103669 TGCTGAGGAGCTGGCTGTCCTGG - Intergenic
1076617572 10:131766177-131766199 TGTTGTGGGCCGTGCTGTCCAGG - Intergenic
1077388664 11:2288733-2288755 TGCTGTTCTCCCTGCTGTCCAGG + Intergenic
1077433556 11:2527599-2527621 TTCTGTGGCTCTGGCTGTCCAGG + Intronic
1077494681 11:2881156-2881178 TGCTGTGTGCCTGGCGGTCCTGG + Intergenic
1079411029 11:20187749-20187771 CTCTGTGGCCCTTGCTGTCTTGG - Intergenic
1082084010 11:48034114-48034136 TCCTTTGGCCCATGCTGTTCTGG + Intronic
1082791188 11:57347703-57347725 TGAAGTGGCCTGTGCTGTCCAGG + Intronic
1083664311 11:64266339-64266361 TGTTATGGCGCTTTCTGTCCAGG - Exonic
1083899011 11:65634738-65634760 TGCAGTGGCCCTTCCTGTTGGGG + Intronic
1084087706 11:66862134-66862156 TGCTGCGGCTCCTGGTGTCCTGG - Intronic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1086880525 11:92148140-92148162 TGCTGTGACCCTTGCCTTGCTGG + Intergenic
1088621922 11:111693516-111693538 TGTTTTGGCCCTGGCTGTTCAGG + Intronic
1089167464 11:116488262-116488284 TGCTTTTGCTCTTGCAGTCCCGG - Intergenic
1089329658 11:117680614-117680636 CGCTGTGGCCTGTGCTGGCCAGG + Intronic
1089434651 11:118454374-118454396 TGCTGTGCCTGTTGCTGTCTTGG + Intronic
1089735230 11:120546271-120546293 TGCAGTCTCCCTTGCAGTCCTGG + Intronic
1090226629 11:125075811-125075833 TCCTGAAGCCCTTTCTGTCCTGG - Intronic
1090276642 11:125424699-125424721 TGCTGTGTCCCTTGGTGAACTGG + Intronic
1090716714 11:129437650-129437672 GGCTGTGACCCTTGCTTTCTTGG + Intronic
1092277218 12:7070480-7070502 TGGTGGGGCCTTTGCTGTACAGG + Exonic
1096239029 12:49949604-49949626 TGCTGTGGCCACTGGGGTCCTGG - Intergenic
1097814757 12:64060330-64060352 TGCTGTGGTCCTAGCTATTCAGG - Intronic
1101948167 12:109154171-109154193 TGCTGGGGTCCTCCCTGTCCTGG + Intronic
1102558146 12:113742440-113742462 TTTTGTGGCCCTGCCTGTCCTGG - Intergenic
1103373953 12:120440556-120440578 TGCTGTGGTCCCTGGTGCCCGGG - Exonic
1103946178 12:124527949-124527971 TGCTGTGGCCCCATCTGTGCGGG + Intronic
1103961345 12:124610968-124610990 TGTTGGGGCCCCTGCTCTCCAGG + Intergenic
1106272768 13:28170393-28170415 TGCAGTGGACCTTGCTTTCGAGG + Intronic
1106284997 13:28310615-28310637 TACTGTGGCCACTGCTGGCCCGG - Intronic
1106731880 13:32549955-32549977 TCCTGTGGCCATTGCTGTGGGGG - Intergenic
1109232411 13:59774771-59774793 TGCTGGAGGCCTTGCAGTCCGGG - Exonic
1110183038 13:72639750-72639772 AGGTGTGGCCCTTGCTTTCAAGG - Intergenic
1112516679 13:100059132-100059154 TCCTGAGGGCCTTGCTGGCCAGG - Intergenic
1118705772 14:68478990-68479012 TCCTATTGCCCTTGCTGCCCGGG - Intronic
1118882358 14:69840484-69840506 GGCTATGGCCCTTGCTACCCAGG - Intergenic
1121604718 14:95232114-95232136 TTCTGTGGCCTTAGCTGTCTTGG + Intronic
1122072271 14:99212559-99212581 TCCTGTCTCCCTGGCTGTCCTGG - Intronic
1122627073 14:103090234-103090256 TGCTTTGGCCAAGGCTGTCCAGG + Intergenic
1126110455 15:45172035-45172057 TGCTGGGTCCCTCGCTGTCCAGG + Intronic
1126857456 15:52852881-52852903 TCCTGTTTCCCTTGCTGTTCAGG - Intergenic
1126967405 15:54070698-54070720 AGCTGTGGCCTCTGCTGTCCCGG + Intronic
1127012357 15:54644214-54644236 TGCTGTAGCCCTTGGTGACAAGG - Intergenic
1128238090 15:66081079-66081101 TGCTGAGCCCTATGCTGTCCAGG - Intronic
1128314122 15:66649457-66649479 TGAGCTGGCCCTTGCTTTCCGGG + Intronic
1128516897 15:68348098-68348120 TTCTGTCCCCCTTGCAGTCCTGG + Intronic
1128563603 15:68684445-68684467 TCCTGTGGTCCTTTCTGCCCTGG - Intronic
1128984105 15:72206808-72206830 TGATGTGGCCAATGCAGTCCTGG - Exonic
1129318994 15:74763399-74763421 TGCCCTGGGCCTTGCTGACCTGG + Intergenic
1129363953 15:75043074-75043096 TGCTGTGGCCTCTGCGGCCCTGG + Intronic
1131249674 15:90822049-90822071 TGCCCTGGCCCTTGCTTTCTCGG - Intergenic
1131403820 15:92147259-92147281 TGCTGTGGCCCTAGCTCACCTGG - Intronic
1132147371 15:99436798-99436820 TTCTGTGACCCCTGCTGTCCAGG + Intergenic
1132335916 15:101048683-101048705 TGCTGTGGCACCTGCTGACCTGG - Intronic
1132594163 16:740668-740690 TCCTGTGCCCCATGGTGTCCGGG - Intronic
1132621218 16:869083-869105 GGCTGTGCCACTCGCTGTCCAGG + Intronic
1132751294 16:1459077-1459099 TGCGGTGGCCCTGGCTGGGCAGG - Intronic
1132956758 16:2598379-2598401 TTCTGTGGCCCCTGCTGTGTTGG + Exonic
1137593172 16:49706352-49706374 AGCTGTGGCCATGGCTGGCCTGG - Intronic
1137662867 16:50224562-50224584 AACTATGGCCCTTGCTCTCCTGG + Intronic
1137884048 16:52083377-52083399 TGTTGTGGCAGTGGCTGTCCTGG + Intergenic
1137979402 16:53056602-53056624 TGCTGTTTCCCTTGTTGACCAGG + Intronic
1140201792 16:72900836-72900858 TTCCGTGGCCATTGCTGTCCTGG - Intronic
1141452776 16:84116850-84116872 AGCTGTGGGCCTCGCTGGCCCGG - Exonic
1142254090 16:89005741-89005763 TCCTGTGGCATTTGCTCTCCTGG - Intergenic
1142293378 16:89202697-89202719 TGCTGTGGCCTTTTGTGTTCCGG + Intergenic
1142744355 17:1948290-1948312 TCCTGTAGCCCCTGCTTTCCAGG + Intronic
1144654300 17:17025461-17025483 TGCTGTGGGCCTGGCTCCCCTGG + Intergenic
1145234991 17:21202070-21202092 GGCTGTGGCCCTGGGTGTGCGGG + Intronic
1146374675 17:32286027-32286049 AGCTCTGTCCCTTGCTCTCCAGG - Intronic
1146722455 17:35132888-35132910 TCCTGTGGCCCCTGTTGTTCCGG + Intronic
1148464635 17:47857607-47857629 GGCTGTGTTCATTGCTGTCCAGG - Intergenic
1148507811 17:48141987-48142009 TGCTGTGCCCTGTGCTTTCCTGG + Intronic
1149443587 17:56696285-56696307 TGGTGAGGCCCTAGCTGTCCTGG - Intergenic
1149557016 17:57580492-57580514 TTCTGTGGCTCTTCCAGTCCTGG + Intronic
1149561459 17:57610746-57610768 TGCTGCTGCCCTAGGTGTCCAGG + Intronic
1149609815 17:57952033-57952055 TGCTGTGGCCCTGGCTACCATGG - Intronic
1151673303 17:75584940-75584962 TGCTGTGGCCTTTCCTCACCAGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152360908 17:79832601-79832623 TGCCGAGGCCCTTGCTCTTCGGG - Intergenic
1152467470 17:80474335-80474357 TACTGTGCCCATTGCTGGCCAGG - Intronic
1152736494 17:81999906-81999928 TTCTGTCCCCCTGGCTGTCCTGG + Intronic
1152905775 17:82970189-82970211 TGCTGTGGCCTTGGCTGGCCTGG - Intronic
1153669132 18:7393594-7393616 TGCTGTGGACCCTGCTGCCCAGG - Intergenic
1154437455 18:14357750-14357772 GGCTGTGGGCCTAGCTGTGCTGG - Intergenic
1156385950 18:36605402-36605424 TTCTGTGGCATTTGATGTCCAGG + Intronic
1156448299 18:37252941-37252963 TGCTGTGGCTCTTGCAGCCTCGG - Intronic
1157183525 18:45518839-45518861 TGCCCTGGCCTTTGCTCTCCAGG - Intronic
1158122033 18:54059085-54059107 TGCTGTGGCTGTTTCTGTGCAGG - Intergenic
1158959752 18:62579746-62579768 TGCTTTAGCTCTTGCTGCCCAGG + Intronic
1160144166 18:76350316-76350338 GGCGGTGGCCCCAGCTGTCCTGG - Intergenic
1160190025 18:76708243-76708265 CGCTGTGGCTCTTGCTGTTAAGG - Intergenic
1161124483 19:2547988-2548010 TGCTGTGGCCCGTGGGCTCCAGG + Intronic
1161220250 19:3115070-3115092 TGCTGTGGCCCGGGCGGTACCGG - Exonic
1161568862 19:5019004-5019026 TGCTGTGGACATTGGTGTGCAGG + Intronic
1162060031 19:8089481-8089503 TGCTCTGCTCCTTCCTGTCCTGG + Intronic
1162382496 19:10339759-10339781 TGCTGTGGCCCTTGGGGGCCAGG + Exonic
1163602972 19:18259753-18259775 TGCTGGGGTCCATGCTGTTCAGG + Intronic
1164678371 19:30118093-30118115 TTCTGTGGCCTCTGCTGCCCTGG + Intergenic
1164682630 19:30145800-30145822 TTCCGTGACCCTTGCTGTGCTGG + Intergenic
1164877554 19:31702160-31702182 GGCTATGGCCCTTGCTGTCATGG + Intergenic
1165097941 19:33419928-33419950 TGCTGTGACCGCTGCTGTCTTGG - Intronic
1165756930 19:38298958-38298980 TGCTCTGGTCCTTGATGTTCTGG - Intronic
1166060400 19:40322034-40322056 TGCTGGTGACCTGGCTGTCCTGG + Exonic
1166319140 19:42005738-42005760 TGCCGTAGCCCTTGGTGTCGAGG + Exonic
1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG + Exonic
1167782287 19:51606734-51606756 TGCTGTTGCCCCTGCTGTGCAGG - Intergenic
1202711311 1_KI270714v1_random:20758-20780 GGATGTGGCCCTGACTGTCCTGG - Intergenic
925899860 2:8501133-8501155 TGCTGTGCCCCTGGCTGCCAGGG + Intergenic
926149981 2:10420084-10420106 TGATGTAGCCGTTGCCGTCCAGG - Exonic
929465603 2:42141160-42141182 TGCTGTGACTCTTTTTGTCCTGG + Intergenic
932114817 2:69036842-69036864 TGCTCTGGCCCTGGGGGTCCTGG - Intronic
932134771 2:69218715-69218737 TGCTGTGTTCCTGGCTGTCATGG - Intronic
932577333 2:72970036-72970058 TGCTTAGGTCTTTGCTGTCCGGG - Intronic
935171219 2:100612681-100612703 TGCTGTGGCCCGGGCTCCCCTGG + Intergenic
936795365 2:116196649-116196671 TACTTTGGCCCTTGGTGTCAAGG + Intergenic
937125029 2:119469348-119469370 GGCTGTGGCCATTGCTTGCCAGG + Intronic
937224365 2:120359805-120359827 TGCTGTGGGCCTTGGTGGCTGGG + Intergenic
937268038 2:120629668-120629690 TCCTGTGCCCATTGCTGTCCTGG + Intergenic
937301520 2:120845597-120845619 TGCTGTGCCGTTTGCTTTCCAGG - Intronic
938070446 2:128305572-128305594 GGCTGAGGCCCTTGTTCTCCAGG + Intronic
938293135 2:130160931-130160953 GCATGTGGCCCTGGCTGTCCAGG - Intronic
938463416 2:131512034-131512056 GCATGTGGCCCTGGCTGTCCAGG + Intergenic
942087115 2:172453992-172454014 AACTGTGGCCATTGCTGTGCAGG + Intronic
942915969 2:181307408-181307430 AGCTCTGCCCCTTACTGTCCAGG + Intergenic
943353501 2:186822655-186822677 TGCAGTTGCCCTTGGTCTCCTGG - Intergenic
944231759 2:197402071-197402093 TGCTTTGGCCATTGCTGCCTTGG - Exonic
946113093 2:217437430-217437452 TGCTGCCCCCCTTGCTGACCTGG + Intronic
946693284 2:222326093-222326115 TGCTTTGGCCCATGCAGTCTGGG - Intergenic
947564482 2:231185385-231185407 TGCTGTGGAGCTTCCTCTCCTGG - Intergenic
947864513 2:233386951-233386973 TGCATTGGCCTGTGCTGTCCGGG + Intronic
948042798 2:234917004-234917026 TGCTGTGCCCCTTGCTATCAGGG - Intergenic
948193683 2:236079222-236079244 TACTGTGACCCATGCTGGCCAGG + Intronic
948648895 2:239426601-239426623 GGCAGAGGCCCTGGCTGTCCAGG + Intergenic
948845578 2:240681401-240681423 TCCTGTGGCCTTTGTGGTCCAGG + Intronic
948945361 2:241216517-241216539 TGCTCTGGCCCATGCTTTCTAGG - Intronic
1169044956 20:2527836-2527858 TGCTGGGGACTTTGCTCTCCTGG + Intergenic
1169066197 20:2695382-2695404 TGCTGTGGCCCATGCTCTGGGGG - Intronic
1169146953 20:3259004-3259026 CTCTGGAGCCCTTGCTGTCCTGG - Intronic
1169193529 20:3671893-3671915 GGAAGTGGCCCTCGCTGTCCTGG + Exonic
1169469146 20:5868687-5868709 TGCTGCGGCCCTAGCTGTAGTGG - Intergenic
1171419897 20:25011154-25011176 TGCTGTGGACGCTGCTGCCCAGG - Intronic
1172650126 20:36496823-36496845 TCTTGTGGTCCTGGCTGTCCAGG - Exonic
1173249896 20:41358839-41358861 TGCTGTGGACCTTGATACCCTGG + Exonic
1173444929 20:43109104-43109126 TGCTGTTTTCCTTGCTCTCCAGG + Intronic
1174106334 20:48165147-48165169 TTCTGAGCCCCTTTCTGTCCAGG + Intergenic
1174467265 20:50727529-50727551 TGCTCTGCTCCTTGCTGTCTGGG - Intergenic
1175082530 20:56433095-56433117 GGGTGTGGCCCTCGCTCTCCTGG + Intronic
1175301419 20:57945938-57945960 AGCTGTGGCCCTTGGAGGCCAGG + Intergenic
1175523988 20:59621145-59621167 TGCTGAGGTGCTTGCTGTGCAGG + Intronic
1175778234 20:61666360-61666382 CGCAGTGGCCCTGGCTGTGCCGG - Intronic
1176839598 21:13827889-13827911 GGCTGTGGGCCTAGCTGTGCTGG + Intergenic
1178767889 21:35471526-35471548 TCCTGTGGCCCCTGCACTCCTGG + Intronic
1178908545 21:36655634-36655656 TGCTGTGGCTCTCAGTGTCCTGG + Intergenic
1179902911 21:44403046-44403068 TGCTGTGGCCCTGGCTCTGCTGG + Intronic
1180219882 21:46351939-46351961 TCCTGTGGCCCCAGCTCTCCAGG + Intronic
1180612324 22:17105960-17105982 CGCTGGGGCTCTGGCTGTCCTGG + Intronic
1180824776 22:18854834-18854856 TGCTCTGTCCCTTGCTGTCCAGG + Intronic
1180833792 22:18919769-18919791 AGCTGGAGCCCCTGCTGTCCCGG - Exonic
1181066034 22:20306472-20306494 AGCTGGAGCCCCTGCTGTCCCGG + Intergenic
1181125194 22:20697985-20698007 TGCTCTGTCCCTTGCTGTCCGGG + Intergenic
1181187954 22:21119713-21119735 TGCTCTGTCCCTTGCTGTCCAGG - Intergenic
1181211244 22:21290780-21290802 TGCTCTGTCCCTTGCTGTCCAGG + Intergenic
1181398259 22:22636108-22636130 TGCTCTGTCTCTTGCTGTCCAGG - Intergenic
1181464700 22:23104666-23104688 TGCTGGGGGCCTTGCTGACTTGG + Intronic
1181500994 22:23315477-23315499 TGCTCTGTCTCTTGCTGTCCGGG - Exonic
1181651155 22:24259952-24259974 TGCTCTGTCTCTTGCTGTCCAGG + Intergenic
1181706225 22:24650787-24650809 TGCTCTGTCTCTTGCTGTTCAGG - Intergenic
1182877226 22:33702691-33702713 TGCTGTGGTCCCTGTTATCCTGG + Intronic
1183227659 22:36561499-36561521 TGTTCTGCCCCTTGCTGACCTGG + Intergenic
1183585460 22:38750721-38750743 TGCGGTGGCCCCTGGTGCCCTGG - Intronic
1183781853 22:40003844-40003866 TGCTGGGCTCCTTGCAGTCCTGG + Intronic
1183986581 22:41573651-41573673 AGCTGAGGCCCGGGCTGTCCTGG - Exonic
1184066689 22:42125520-42125542 GGCTGTGGCCCTTGCTGGCCTGG - Intergenic
1184069157 22:42137672-42137694 GGCTGTGGCCCTTGCTGGCCTGG - Intergenic
1184452916 22:44593464-44593486 TGAAGTGGTCCTGGCTGTCCGGG + Intergenic
1184728116 22:46357900-46357922 AGCCGTGGCCCTTGCTGGGCTGG + Intergenic
1184737461 22:46407843-46407865 TGCTGTGACCCTTTCTGATCAGG - Intronic
1185176767 22:49332098-49332120 TGCGGTCGCCCTTGCTGCCATGG - Intergenic
1185266779 22:49908179-49908201 TCCTGTGGCCCTTGCTGCCTTGG - Intronic
1185301077 22:50081561-50081583 GCCTGTGGCCCTTGCCGTGCAGG + Intronic
1203215705 22_KI270731v1_random:4651-4673 TGCTCTGTCCCTTGCTGTCCAGG - Intergenic
1203274921 22_KI270734v1_random:80740-80762 TGCTCTGTCCCTTGCTGTCCAGG + Intergenic
1203283878 22_KI270734v1_random:145067-145089 AGCTGGAGCCCCTGCTGTCCCGG - Intergenic
949847235 3:8384061-8384083 TGCTGTGGCTGTGGCTGCCCCGG + Intergenic
950032118 3:9860173-9860195 TTCTGCAGGCCTTGCTGTCCAGG - Intergenic
950831455 3:15879433-15879455 GGCTGTGGGCCCTGCTATCCTGG - Intergenic
951204245 3:19909428-19909450 TGCTGTAGCCCTTGGTGGCGAGG - Intronic
953744980 3:45567222-45567244 TGCTGTGGAGCTGGTTGTCCTGG - Intronic
954416451 3:50395735-50395757 AGCTGTGGCCTCTGCTCTCCTGG + Intronic
955359266 3:58258930-58258952 TGCTGTTGCCCTTGCAGTGCTGG + Intronic
957802424 3:85102698-85102720 TGCTGTGGCTATTCTTGTCCTGG + Intronic
961381514 3:126498957-126498979 TGCTGTGGCCCTGGGGGTCGTGG - Intronic
961611674 3:128144644-128144666 AGGTGAGGCCCTTGCTCTCCAGG + Intronic
961784870 3:129341610-129341632 TTCTGCAGGCCTTGCTGTCCAGG - Intergenic
964316417 3:155449166-155449188 TGCTGTGTCCCTGTGTGTCCAGG - Intronic
966948513 3:184795345-184795367 AGCTGTGGTTCCTGCTGTCCTGG + Intergenic
967501206 3:190200173-190200195 TGCTGTTGCCCTTGTTGCCCAGG - Intergenic
967826385 3:193880997-193881019 GGCTGTGGCCATTGGTGTGCAGG - Intergenic
968712667 4:2130374-2130396 TGCTGGGGGCCCTGCTGTGCAGG - Intronic
968831199 4:2933780-2933802 TGCTGCTGCCCCTGCTGCCCGGG - Exonic
968966607 4:3772128-3772150 TGCCGTGGCACTTGCTGGCGAGG + Intergenic
968984447 4:3867483-3867505 TGCTGTGGCCCTTGTCCTCGGGG + Intergenic
969116433 4:4873214-4873236 TGCTGAGGCCCCTGCTGTGCTGG + Intergenic
969118387 4:4888834-4888856 TGAGGTGGTCCTTGCTGTCAAGG + Intergenic
969427813 4:7136060-7136082 TGCTATGCCCCTGGCTGTCTGGG + Intergenic
969688702 4:8691408-8691430 TGCTCAGCCCCTTCCTGTCCTGG + Intergenic
970112692 4:12656536-12656558 AGCTGAGGCCTCTGCTGTCCAGG + Intergenic
974055100 4:56976723-56976745 CGCTGTGGCCCTTGGTGGCCAGG + Exonic
975448745 4:74500159-74500181 TGCAGTGTTCCTTGCTCTCCAGG - Intergenic
979413371 4:120406300-120406322 TGATGTGGCCCTTGGTGGCGAGG - Intergenic
979859006 4:125670226-125670248 TGGTGTGGCACCTGCTGTACTGG + Intergenic
981511402 4:145562588-145562610 TTCTGTGCCCCTTGCTATCATGG - Intergenic
981748232 4:148070930-148070952 ACCTGTGCCCTTTGCTGTCCAGG + Intronic
982026654 4:151258639-151258661 TGCGGCGTCCCCTGCTGTCCTGG - Intronic
985347495 4:189021998-189022020 TGCTGAGTCATTTGCTGTCCTGG - Intergenic
986500015 5:8388846-8388868 TGCTATGGCTATTTCTGTCCAGG - Intergenic
990475230 5:56156234-56156256 TGTTGAGGCCCTTGCTCTGCTGG + Intronic
990791095 5:59480939-59480961 TGCCCTGGTCATTGCTGTCCTGG - Intronic
991034453 5:62114079-62114101 AGGTGTGGCCCTTGCTTTCAAGG + Intergenic
991291026 5:65034226-65034248 TGCTGTAGCACTTACTGTACTGG + Intergenic
992102155 5:73418437-73418459 TGCAGTGCCCTTTGCTGTCTTGG - Intergenic
993582209 5:89677101-89677123 TGCTGTAGCCCTTGGTGGCATGG - Intergenic
994088852 5:95790684-95790706 TGCAGTGCCTCTTCCTGTCCAGG + Intronic
994239864 5:97407281-97407303 TGCTGAGCCCCTCACTGTCCGGG - Intergenic
994512317 5:100720264-100720286 TGCTGTGCCCCTTTCTGTAGTGG + Intergenic
995527418 5:113061287-113061309 TGCTGTGGCCGATCCTGTCTTGG + Intronic
997375497 5:133394470-133394492 TGCTAAGCCCCTCGCTGTCCGGG - Intronic
998147974 5:139740904-139740926 TGCTGTTGCCCCTGCTTTGCAGG - Intergenic
999130819 5:149281961-149281983 TGCTGTGGCCCTTGGAGTTCTGG + Intronic
999735411 5:154509399-154509421 TGTTGAGGCCCTTCGTGTCCTGG - Intergenic
1001542540 5:172549746-172549768 GGGTGTGCCCCTTGCTGTGCTGG - Intergenic
1002564061 5:180100164-180100186 TGCTGTGGTCCTGGCTCACCAGG + Intergenic
1002602898 5:180364157-180364179 TCCTCTGGCCTTTGCTGCCCTGG + Intergenic
1002714993 5:181221608-181221630 TGCTGTGAGACTTGCTGTGCTGG - Intergenic
1003175272 6:3749493-3749515 TGCTGTCGCCCTAGTTGTGCTGG - Intronic
1003325884 6:5090501-5090523 AGCCGTGGCTCTTGCTGCCCTGG - Intergenic
1005761328 6:28970405-28970427 TGGTGAAGCTCTTGCTGTCCGGG + Intergenic
1006359895 6:33581490-33581512 TGCTGTTGCCCAGGCTGGCCTGG - Intergenic
1006468391 6:34210506-34210528 TGGTGTGGCCCAGGCTGGCCTGG + Intergenic
1006843269 6:37045208-37045230 TGCTGTGGTCCCTGGTGCCCGGG - Exonic
1007566739 6:42857298-42857320 TGATGTGGCTCTTGCTTTTCTGG - Intronic
1008572546 6:52829437-52829459 TGCTGTGCCCCTCACTGCCCAGG + Intergenic
1009994870 6:70886718-70886740 TGCTGTGGCCAGGGCTGTGCTGG - Intronic
1011193743 6:84762748-84762770 TTCTCTGTCCTTTGCTGTCCAGG - Exonic
1012608069 6:101182774-101182796 TGCTGTAGCTCTTGCTGCACTGG + Intergenic
1015156999 6:130107958-130107980 TGGTGTTGCTCTTGCTGTGCTGG - Intronic
1015310850 6:131765725-131765747 AGCTGCGGCCCTGGCTGTCAGGG + Intergenic
1016647219 6:146424231-146424253 TGCAGTGGCACTTCCGGTCCAGG + Intronic
1017824068 6:158068838-158068860 AGCTGTGGCCCTGGCTGTGTGGG + Intronic
1018067188 6:160132346-160132368 TCCAGTTGCCCTTGCTGACCAGG - Exonic
1018104919 6:160476344-160476366 TGCTTTTGCTCTTCCTGTCCTGG + Intergenic
1018633579 6:165841359-165841381 CCCTGTGGCCTTTGCTGACCAGG + Intronic
1018792284 6:167157706-167157728 CGCTGTGGACCTTCCTGTTCCGG - Exonic
1019145813 6:169974983-169975005 TGCTGTGGCCCTGGGTGCCAGGG + Intergenic
1019285089 7:219381-219403 TGGGCTGGCCATTGCTGTCCTGG - Intronic
1019997515 7:4734355-4734377 GGCTGTGGCTCTTGTGGTCCTGG + Intronic
1020386497 7:7610216-7610238 TACTGTGAGACTTGCTGTCCCGG + Intergenic
1021254177 7:18369638-18369660 TGCTGTGGACTTTGCAGTACAGG + Intronic
1022858060 7:34336220-34336242 TGCTGTAAGCCTTGCAGTCCTGG - Intergenic
1023874346 7:44278576-44278598 TCCTGTGGCCTCTGCTGCCCTGG - Intronic
1024185838 7:46946879-46946901 TCCTGTTCCCCTTGCTGTGCAGG + Intergenic
1025986974 7:66462552-66462574 TGCTATGCTCCTTGCTGTCCAGG + Intergenic
1026028046 7:66762892-66762914 TGCTGTGGCCCTTGCTGTCCAGG - Intronic
1027165341 7:75830111-75830133 TCCTGTGCCCCTTGCCTTCCTGG - Intergenic
1027210241 7:76141379-76141401 TGCCATGCTCCTTGCTGTCCAGG + Intergenic
1029306764 7:99625359-99625381 CTCTGTGGCCATTGCTGTTCTGG + Intronic
1029735860 7:102465360-102465382 GGCTGTGCCCCTAACTGTCCGGG - Intronic
1031799402 7:126223597-126223619 TGCTGTGGCCACTGCTGGGCGGG + Intergenic
1033251379 7:139763191-139763213 TGCTGTGATCCATGCTGTTCAGG + Intronic
1034001649 7:147419910-147419932 TGCTATGCCACTTGCTGTGCTGG + Intronic
1034462712 7:151206816-151206838 TGCTTTGGCTCCTGCTGGCCCGG + Intergenic
1035462951 7:159056469-159056491 TGCTGTGGACCCTGCTGGACTGG + Intronic
1036477009 8:9102663-9102685 TGCAGTGGCACTGGCTCTCCTGG + Intronic
1041257490 8:55991645-55991667 TGCTGAGCCCACTGCTGTCCTGG - Intronic
1042293862 8:67199195-67199217 TGCTGTGGACCCTGCTTTCCTGG - Intronic
1044719220 8:95129652-95129674 TGCTGTGGCGCTCACTGCCCTGG - Intergenic
1044822930 8:96169590-96169612 TCCTGTTGTCCTTGCTGTGCAGG - Intergenic
1045640673 8:104247011-104247033 TGTTGCTGCCCTTGCTGTCCTGG - Intronic
1046380146 8:113438984-113439006 TGCTGTTGCCTTTGCTGGGCTGG + Intergenic
1047958604 8:129994617-129994639 TGCTGTGGGCCTTGGTGACATGG - Intronic
1047975353 8:130124550-130124572 TCCTGTGTCCTTTTCTGTCCTGG - Intronic
1048369398 8:133764469-133764491 AGGTGTGGCTCTTGCTGTCATGG - Intergenic
1049105269 8:140608801-140608823 TTCTATGACCCTTGCTGCCCTGG - Intronic
1049545389 8:143228431-143228453 TGCTGCTTCCCTTTCTGTCCTGG + Intergenic
1049636315 8:143691421-143691443 TTCCGTGGGCCTTGGTGTCCAGG + Intronic
1049661248 8:143820570-143820592 TGCTGGGGACCTTGCTCCCCTGG - Intronic
1049673916 8:143881297-143881319 TCCTCTGGCCCTTCCTCTCCTGG - Intergenic
1052879050 9:33589351-33589373 TGCAGCAGCCCTTGCTGTACAGG + Intergenic
1053496926 9:38554868-38554890 TGCAGCAGCCCTTGCTGTACAGG - Intronic
1053663370 9:40300145-40300167 TGCAGCAGCCCTTGCTGTCACGG + Intronic
1054521244 9:66076140-66076162 TGCAGCAGCCCTTGCTGTCAGGG - Intergenic
1055021820 9:71678350-71678372 TCCTGTGGCCCTTGTTATACTGG - Intergenic
1057676836 9:97142425-97142447 TGCAGCAGCCCTTGCTGTACAGG - Intergenic
1058152272 9:101476259-101476281 TGCTGGGGCCCTTACTAACCTGG - Exonic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1059539458 9:115116364-115116386 TGCTTTGGCCCTTGCATTTCAGG - Intronic
1060736011 9:126066982-126067004 AGTTGTGACCCTTCCTGTCCTGG - Intergenic
1061273704 9:129557923-129557945 TGCTGGGGACCTGGCTGTCAGGG + Intergenic
1061660475 9:132126857-132126879 TCCTCTGCCCCTGGCTGTCCTGG + Intergenic
1061729662 9:132604036-132604058 TGCTGTGGGCCTTGCTTTTCGGG - Intronic
1061757743 9:132827120-132827142 GGCTGGGGTGCTTGCTGTCCTGG + Intronic
1061896489 9:133651228-133651250 TGCTGAAGAGCTTGCTGTCCAGG - Intronic
1062494800 9:136826648-136826670 TCTTGTGGCCCGTGCTGACCTGG + Intronic
1186255725 X:7716770-7716792 TTGTTTGGCCCTTACTGTCCTGG - Intergenic
1187237669 X:17483695-17483717 AGCAGTGGAGCTTGCTGTCCAGG + Intronic
1187587081 X:20675201-20675223 TGCTGTTGCCACTGCTGTCAAGG + Intergenic
1187819661 X:23273661-23273683 TTCTGTGGCCCGTGCTGCTCTGG - Intergenic
1189244885 X:39555668-39555690 TGATGGGGCCTTTGGTGTCCTGG + Intergenic
1190651254 X:52570914-52570936 TGCTGTCGAACTTGCTGCCCAGG - Intergenic
1191942794 X:66498874-66498896 TGATGTGGCCAATGCAGTCCTGG + Intergenic
1193915584 X:87358223-87358245 TGCTGTGGTCCTTGCAGACTCGG - Intergenic
1196258349 X:113548940-113548962 AGGTCTGGCCTTTGCTGTCCTGG + Intergenic
1196759296 X:119186944-119186966 TGCTGGGGCTCCTGCTCTCCTGG + Intergenic
1197804419 X:130385405-130385427 TGGAGTGATCCTTGCTGTCCTGG - Exonic
1198694785 X:139324459-139324481 TGCTGTAGCCCTTGGTGGCAAGG - Intergenic
1198834839 X:140794175-140794197 CAGTGTGGCCCTTCCTGTCCTGG + Intergenic
1200091517 X:153638309-153638331 TGCTGAGCCCCTTGCTGCTCTGG - Intergenic
1200885408 Y:8262809-8262831 TGTTGTGTATCTTGCTGTCCAGG - Intergenic