ID: 1026045673

View in Genome Browser
Species Human (GRCh38)
Location 7:66904076-66904098
Sequence CGCAGCCACGAGCAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026045673_1026045683 22 Left 1026045673 7:66904076-66904098 CCAGCTCCTTGCTCGTGGCTGCG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1026045683 7:66904121-66904143 CTGAACATCCTCCTGTGACTCGG 0: 1
1: 0
2: 1
3: 20
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026045673 Original CRISPR CGCAGCCACGAGCAAGGAGC TGG (reversed) Intergenic
900387928 1:2419115-2419137 CGCAGGGAAGGGCAAGGAGCTGG - Intergenic
900583392 1:3420468-3420490 CGCAGCCCCGCGCAAGCAGGAGG + Intronic
904486233 1:30826062-30826084 CGTAGCCACCACCTAGGAGCTGG + Intergenic
905907065 1:41626248-41626270 CCCAGCCACCAGGGAGGAGCTGG - Intronic
907221708 1:52911805-52911827 GGCAGCCACGGGAAAGCAGCTGG + Intronic
909706534 1:78591603-78591625 CACTGCCACTCGCAAGGAGCAGG - Intergenic
911660128 1:100491922-100491944 CGCAGCCACCCGAGAGGAGCTGG + Intronic
913096396 1:115521185-115521207 AGCAACCAGGAGCAAAGAGCAGG - Intergenic
923101572 1:230821724-230821746 AGCAGCCAGGAGGCAGGAGCAGG + Intergenic
1065857660 10:29843292-29843314 TGCATCCACGAACGAGGAGCTGG + Intergenic
1067038295 10:42934621-42934643 CCCTGGCAGGAGCAAGGAGCAGG - Intergenic
1069527527 10:69186176-69186198 CTCAGCCAGAAGCAAAGAGCAGG - Intronic
1070141925 10:73744573-73744595 CGCATCCACCATCCAGGAGCAGG + Intronic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1073064667 10:100750926-100750948 TGCAGGCAGGAGCCAGGAGCTGG - Intronic
1075044166 10:119133080-119133102 GGTAGACACCAGCAAGGAGCTGG - Intronic
1077252925 11:1568566-1568588 GGCAGCCACCACCATGGAGCAGG + Intronic
1083201047 11:61121312-61121334 GGCAGCCACCAGCAGGGAGTCGG - Intronic
1083619579 11:64042295-64042317 AGCTGCCACGAGGAAGGGGCTGG + Intronic
1083868465 11:65471701-65471723 GGCAGCCACCAGCAATCAGCAGG - Intergenic
1084008525 11:66335431-66335453 CGCAGCCACTCACAAAGAGCTGG - Exonic
1085305886 11:75485942-75485964 GGCAGCCACGGCCAAGGAGAAGG - Intronic
1085383712 11:76143333-76143355 CGCTGGCACCACCAAGGAGCAGG + Intergenic
1085535457 11:77214654-77214676 CACAGCCATGAGCAAACAGCGGG + Exonic
1085727442 11:78966593-78966615 CACAGCCCAGTGCAAGGAGCTGG + Intronic
1087944495 11:104141784-104141806 CGCAGCCAAGAGCAGGTAACAGG + Intronic
1089132593 11:116224259-116224281 CCCAGCCAGGGGCATGGAGCGGG - Intergenic
1090157920 11:124460982-124461004 CACAGCCACCATCAGGGAGCAGG - Intergenic
1094317463 12:29149338-29149360 CGTAGCCTCGGGGAAGGAGCAGG + Exonic
1094499336 12:31008482-31008504 GGCAGCCATGAGTCAGGAGCTGG + Intergenic
1096072522 12:48783188-48783210 CCCAGGCAAGGGCAAGGAGCTGG - Exonic
1096571873 12:52528052-52528074 GGCAGCCTCATGCAAGGAGCTGG - Intergenic
1100565235 12:95789490-95789512 AGAAACCACGAGCCAGGAGCCGG + Intronic
1102210400 12:111122760-111122782 TGCAGCCACGAGCAACTAGCCGG - Intronic
1104041417 12:125133751-125133773 CTCAGGCACCAGCAAGGACCCGG - Intronic
1105867322 13:24472719-24472741 CGCAGCCAGGAGCTCGCAGCAGG - Intronic
1107566930 13:41614420-41614442 GGCAGCCAAGAGGAAGGAGTCGG + Intronic
1113006859 13:105715090-105715112 CGCAGCAACATGGAAGGAGCTGG - Intergenic
1113820446 13:113209268-113209290 CGCATCCCCGAGCCAGGAGGGGG + Intronic
1119457690 14:74770229-74770251 CTCAGCCACCCGCAAGTAGCCGG - Intronic
1121665351 14:95667685-95667707 CCCAGACAGGAGCAAGGAGGGGG - Intergenic
1121698132 14:95929330-95929352 CCCAGCCAAGAGCAGGAAGCAGG + Intergenic
1121714388 14:96062611-96062633 AGCAGCCGTGAGCAGGGAGCTGG - Intronic
1122814748 14:104306936-104306958 TGCAGCCAGGCGCAAGAAGCAGG + Intergenic
1123435540 15:20251485-20251507 CGCAGCCATGAGCCAGGCGCTGG - Intergenic
1124651265 15:31476118-31476140 CGCTGTTAGGAGCAAGGAGCAGG - Exonic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1128480815 15:68036416-68036438 CCGAGGCACAAGCAAGGAGCAGG + Intergenic
1129239340 15:74242386-74242408 CCCAGACAGGAGCAAGGACCTGG - Intronic
1129577373 15:76764586-76764608 CAGAGCCAAGAGCAAGGACCAGG + Intronic
1129852341 15:78800589-78800611 CCCGGCCACCAGCAAGGACCCGG - Intronic
1133269557 16:4604016-4604038 TGGAGCCACGAGCAAGGTGAGGG - Intergenic
1136849066 16:33599510-33599532 CGCAGCCATGAGCCAGGTGCTGG + Intergenic
1137617972 16:49858063-49858085 CGGAGCCAGGAGAACGGAGCGGG + Intergenic
1139960216 16:70713326-70713348 TGCAGCCACCAGCATAGAGCAGG + Intronic
1140558242 16:75946316-75946338 AGCAGCCACGAGAAAGTAGTCGG - Intergenic
1140558874 16:75954329-75954351 CACAGCCACACCCAAGGAGCAGG + Intergenic
1203110773 16_KI270728v1_random:1448160-1448182 CGCAGCCATGAGCCAGGTGCTGG + Intergenic
1142892027 17:2949945-2949967 CTCAGCCATGAGCAACGTGCTGG - Intronic
1143765781 17:9136881-9136903 TTCTGCCACGAGGAAGGAGCTGG - Intronic
1147475489 17:40707870-40707892 AGCAGCCACCAGCAGGAAGCTGG - Intergenic
1147721275 17:42541012-42541034 CGGAGCCAGAAGGAAGGAGCAGG - Exonic
1149605931 17:57925338-57925360 GGCAGCCCCGAGCAATGAGATGG + Intronic
1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG + Intronic
1151603075 17:75118529-75118551 CACAGCCATGAGGAAGGATCCGG + Intronic
1151692286 17:75694038-75694060 GGGAGCCACGTGAAAGGAGCTGG - Intronic
1151780099 17:76240112-76240134 CGCAGCCGCGAGGAGGGAGAGGG - Intronic
1153716892 18:7859379-7859401 GGCTGCCACCAGCAAGGATCAGG - Intronic
1157006554 18:43590215-43590237 AGCAGGCAGGAGCAGGGAGCAGG - Intergenic
1157037328 18:43990658-43990680 CGCAGTCACGTGGATGGAGCTGG - Intergenic
1157210699 18:45739640-45739662 CACAGCCAAGAGCCAGGAGGTGG - Exonic
1161199527 19:3006645-3006667 CGCAGACACGTGGAAGGAGTAGG + Exonic
1161769542 19:6223804-6223826 CGCACCCAGGAGCACTGAGCAGG + Intronic
1164415632 19:28044694-28044716 CACAGCCCTGAGCAATGAGCAGG + Intergenic
1164533456 19:29065535-29065557 CGCAGTCACAGGCAGGGAGCAGG + Intergenic
1164624141 19:29715323-29715345 CGCAGCTCGGAGCCAGGAGCTGG - Intronic
1164876458 19:31694039-31694061 CTCAGCCACAAACAAGGAGCAGG + Intergenic
1165031699 19:33002355-33002377 CGCAGCCATGAGCCAGGCGCCGG - Exonic
1166170176 19:41022782-41022804 CAAAGGCACCAGCAAGGAGCTGG - Intergenic
1167621696 19:50564365-50564387 GGGAGCCACGGGGAAGGAGCAGG + Intronic
926532058 2:14060445-14060467 CTCAGCCCCCACCAAGGAGCTGG - Intergenic
927481322 2:23456559-23456581 AGCACCCACGAGTGAGGAGCCGG + Intronic
929808690 2:45170029-45170051 CCCAGCCCCGAGCTGGGAGCCGG - Intergenic
935455726 2:103265772-103265794 CGAAGCCAAGAGCAAGGAGTTGG + Intergenic
938909779 2:135875821-135875843 CGCAGCCGGGAGCATGGTGCTGG - Intronic
940023475 2:149180711-149180733 CACAGCCAGGATCAAGGATCAGG - Intronic
941369176 2:164643296-164643318 CGAAGCCACCAGCTAGGAACAGG + Intergenic
944104815 2:196068696-196068718 CGCAGCCATGAGCAGTGAGCAGG - Exonic
945148708 2:206765326-206765348 CGCAGCCAAGGGCAAGGCGCAGG + Exonic
948582226 2:238996353-238996375 CTCAGCCACCAGGAAGGACCGGG + Intergenic
948846105 2:240683495-240683517 CACAGCCAGGAGCAGGGAGCAGG - Intergenic
1169873933 20:10275503-10275525 CGCAGACATGCGCAATGAGCTGG + Exonic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1171437078 20:25132058-25132080 ATAAGTCACGAGCAAGGAGCTGG + Intergenic
1173814477 20:45976385-45976407 TGCAGCCAGGAGGATGGAGCTGG + Intergenic
1174194231 20:48761663-48761685 CGCAGCCCCCATCAAGGGGCTGG + Intronic
1174467964 20:50731793-50731815 CGCAGCCACCGGCACGGGGCGGG + Exonic
1175173331 20:57094463-57094485 CGCAGCCACAAGCAAAGGACAGG - Intergenic
1177833821 21:26169663-26169685 CGCAGCCCCGGGAAGGGAGCCGG + Intronic
1179842648 21:44087339-44087361 CCCAGCCACGAGGAAGGGGAAGG + Intronic
1179887672 21:44321360-44321382 CACAGCCACGAGTAAGGAAGGGG - Intronic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1182299789 22:29331056-29331078 CGCAGCCAGGGGCAGGGTGCAGG + Intronic
1183082835 22:35467848-35467870 CTCAGCCAGAAGGAAGGAGCAGG - Intergenic
1183211599 22:36454894-36454916 CCCACCCACGAGCCAGGAGTCGG - Intergenic
1184291831 22:43501487-43501509 GGCAGCCCCGAGACAGGAGCCGG - Intronic
1184443585 22:44534232-44534254 CCCAGCCAGGAGGAAGTAGCAGG + Intergenic
1185319728 22:50195044-50195066 CGCAGCCGCGGGCAAGGGTCAGG + Intronic
950272949 3:11633755-11633777 AGGAGCCACGAGAAAGGAACAGG + Intronic
950669893 3:14519670-14519692 CCCAGCTATGAGCAGGGAGCTGG - Intronic
953202613 3:40790927-40790949 TCCAGCCACCAGCAAGGAGAAGG + Intergenic
953904677 3:46862538-46862560 CCCAGCCAAGAACAGGGAGCAGG + Intronic
961042712 3:123688674-123688696 TGGAGCCATGAGCAAGGGGCAGG - Intronic
961324811 3:126103742-126103764 CCCAGCCACGAGGGAGGGGCAGG + Exonic
961497515 3:127305120-127305142 AGCAGCCAGGAACAGGGAGCAGG - Intergenic
967518894 3:190404829-190404851 CGCAGTCAAGACCAAGGAGCAGG - Exonic
969021452 4:4142765-4142787 CCCAGCCAGGAGAAGGGAGCGGG - Intergenic
969274303 4:6124689-6124711 CCCAGGCTGGAGCAAGGAGCAGG - Intronic
969281796 4:6175694-6175716 CCCAGGCACGAGCAGGGTGCTGG - Intronic
969648563 4:8448648-8448670 CACAGTCCCGAGCAGGGAGCTGG + Intronic
969921855 4:10547651-10547673 GGCTGCCAGGAGCAAGGAGGAGG - Intronic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
985579709 5:690213-690235 CTCAGCCAGGAGCCAGGATCAGG - Intronic
985594555 5:782272-782294 CTCAGCCAGGAGCCAGGATCAGG - Intergenic
985833907 5:2256934-2256956 TGCAGGCACCAGCCAGGAGCAGG - Intergenic
992783582 5:80149553-80149575 CGCAGTCAGCAGCAAGGACCAGG + Intronic
996055052 5:118973605-118973627 GGCTGCCGCGAGCAAGGAGGCGG - Intronic
996666275 5:126064028-126064050 AGCAGCCAGGAGCATGCAGCAGG + Intergenic
997616459 5:135249454-135249476 AGAAGCCACGAGCGAGAAGCAGG - Intronic
1001294348 5:170488728-170488750 CGAAGCCAAGAGCAAGGACTGGG + Intronic
1001746114 5:174093630-174093652 CTCAGCCAGGAACAAGGTGCCGG + Intronic
1001763299 5:174225085-174225107 GGCAGCCACGAGCCAGGAGGAGG - Intronic
1003102909 6:3190875-3190897 GGCAGCCAGGAATAAGGAGCAGG + Intergenic
1003958700 6:11190035-11190057 CCCAGGCCTGAGCAAGGAGCAGG - Exonic
1004260677 6:14104840-14104862 CCCAGCCACGCACAAGGAACTGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1007765344 6:44156591-44156613 CCCAGGCGCCAGCAAGGAGCAGG + Intergenic
1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG + Exonic
1012542036 6:100372541-100372563 CACAGCCAACAGCCAGGAGCTGG + Intergenic
1013524148 6:110958942-110958964 CGCGCCCAGGAGCAAGAAGCCGG - Intronic
1015077899 6:129184658-129184680 TATAGCCACGAGCAAGGATCAGG - Intronic
1018007880 6:159640411-159640433 CACAGCCAAGTGCAAGCAGCAGG + Intergenic
1018920352 6:168168129-168168151 AGCAGCCAGCAGCAAGGGGCGGG + Intergenic
1019129399 6:169862654-169862676 TGCAGCCAGGAGCCAGGACCTGG - Intergenic
1019421668 7:953876-953898 AGCAGCCAGGTGCAGGGAGCCGG + Intronic
1020308874 7:6854794-6854816 CTCAGCCAGGAGAAGGGAGCGGG - Intergenic
1023316004 7:38937560-38937582 TGCAAACACCAGCAAGGAGCAGG + Intergenic
1023747673 7:43336846-43336868 CGCAGCAACGTGGATGGAGCTGG - Intronic
1024087028 7:45902222-45902244 TGCAGTCAAGAGCAAGGAGGTGG + Intergenic
1024965633 7:55020024-55020046 CGCAGCCTCGACCTGGGAGCTGG + Intronic
1025976805 7:66376835-66376857 CGCAGACGCGAGCAAAGAGCTGG + Intronic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1026211797 7:68312485-68312507 CCCATCCAAGAGCCAGGAGCAGG + Intergenic
1026451540 7:70533778-70533800 CACAGCAACCAGCAGGGAGCTGG + Intronic
1027203014 7:76074602-76074624 CGCAGCCATGAGCAAATAGCTGG + Intergenic
1028413780 7:90558501-90558523 AGGAGCCCCGAGCAAGGACCAGG + Intronic
1029495756 7:100894997-100895019 CCCCGCCCCGAGCCAGGAGCCGG + Intronic
1033418033 7:141181680-141181702 CACAACCACGAGCTAGGACCAGG + Intronic
1035239456 7:157520353-157520375 GGCAGCCACCAGCCTGGAGCAGG - Intergenic
1035627880 8:1087416-1087438 CACAGCCTTGAGAAAGGAGCTGG - Intergenic
1035681610 8:1492733-1492755 CGTCGCCATGAGCATGGAGCCGG - Intergenic
1036596857 8:10220967-10220989 TTCAGCCAAGAGCAAGGAACGGG - Intronic
1037604230 8:20423890-20423912 CGGAGACAGGAGCATGGAGCTGG - Intergenic
1037804536 8:22051684-22051706 AGCAGTCACGCGCAAGGAGGCGG - Intronic
1037876189 8:22549799-22549821 GGCAGCCATGGGTAAGGAGCTGG - Intronic
1041081498 8:54219105-54219127 TGGAGCAAGGAGCAAGGAGCAGG - Intergenic
1044631629 8:94285639-94285661 CACAGCCAGAAGCAAGAAGCAGG + Intergenic
1057057831 9:91977559-91977581 TGCAGTCACCAGCCAGGAGCTGG - Intergenic
1057141860 9:92731218-92731240 CACACCCACGAGCCTGGAGCTGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1060106796 9:120877472-120877494 CGCGGCCACTAGCCAGGACCCGG + Intronic
1061238787 9:129357458-129357480 CTCAGCCAGGAGCCAGGACCAGG - Intergenic
1061349650 9:130054171-130054193 CGCAGCCAGGGGCAAAGAGGTGG - Intronic
1062686826 9:137817963-137817985 CGCAGCCACAGGGAAAGAGCAGG - Intronic