ID: 1026046487

View in Genome Browser
Species Human (GRCh38)
Location 7:66909082-66909104
Sequence CTTCACTTATTACTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026046487_1026046493 23 Left 1026046487 7:66909082-66909104 CCAAAGCCCAGTAATAAGTGAAG No data
Right 1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG No data
1026046487_1026046491 18 Left 1026046487 7:66909082-66909104 CCAAAGCCCAGTAATAAGTGAAG No data
Right 1026046491 7:66909123-66909145 GAGTAGTTATATGCAGAAGATGG No data
1026046487_1026046492 22 Left 1026046487 7:66909082-66909104 CCAAAGCCCAGTAATAAGTGAAG No data
Right 1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG No data
1026046487_1026046490 -6 Left 1026046487 7:66909082-66909104 CCAAAGCCCAGTAATAAGTGAAG No data
Right 1026046490 7:66909099-66909121 GTGAAGAGCTGTCTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026046487 Original CRISPR CTTCACTTATTACTGGGCTT TGG (reversed) Intergenic
No off target data available for this crispr