ID: 1026046488

View in Genome Browser
Species Human (GRCh38)
Location 7:66909088-66909110
Sequence ACAGCTCTTCACTTATTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026046488_1026046492 16 Left 1026046488 7:66909088-66909110 CCCAGTAATAAGTGAAGAGCTGT No data
Right 1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG No data
1026046488_1026046493 17 Left 1026046488 7:66909088-66909110 CCCAGTAATAAGTGAAGAGCTGT No data
Right 1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG No data
1026046488_1026046491 12 Left 1026046488 7:66909088-66909110 CCCAGTAATAAGTGAAGAGCTGT No data
Right 1026046491 7:66909123-66909145 GAGTAGTTATATGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026046488 Original CRISPR ACAGCTCTTCACTTATTACT GGG (reversed) Intergenic
No off target data available for this crispr