ID: 1026046490

View in Genome Browser
Species Human (GRCh38)
Location 7:66909099-66909121
Sequence GTGAAGAGCTGTCTCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026046485_1026046490 18 Left 1026046485 7:66909058-66909080 CCATAGTCAAATGTTCAGTTTCC 0: 53
1: 132
2: 165
3: 111
4: 311
Right 1026046490 7:66909099-66909121 GTGAAGAGCTGTCTCTCAAAAGG No data
1026046486_1026046490 -3 Left 1026046486 7:66909079-66909101 CCACCAAAGCCCAGTAATAAGTG No data
Right 1026046490 7:66909099-66909121 GTGAAGAGCTGTCTCTCAAAAGG No data
1026046487_1026046490 -6 Left 1026046487 7:66909082-66909104 CCAAAGCCCAGTAATAAGTGAAG No data
Right 1026046490 7:66909099-66909121 GTGAAGAGCTGTCTCTCAAAAGG No data
1026046484_1026046490 19 Left 1026046484 7:66909057-66909079 CCCATAGTCAAATGTTCAGTTTC 0: 60
1: 133
2: 160
3: 122
4: 259
Right 1026046490 7:66909099-66909121 GTGAAGAGCTGTCTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026046490 Original CRISPR GTGAAGAGCTGTCTCTCAAA AGG Intergenic
No off target data available for this crispr