ID: 1026046493

View in Genome Browser
Species Human (GRCh38)
Location 7:66909128-66909150
Sequence GTTATATGCAGAAGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026046487_1026046493 23 Left 1026046487 7:66909082-66909104 CCAAAGCCCAGTAATAAGTGAAG No data
Right 1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG No data
1026046488_1026046493 17 Left 1026046488 7:66909088-66909110 CCCAGTAATAAGTGAAGAGCTGT No data
Right 1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG No data
1026046486_1026046493 26 Left 1026046486 7:66909079-66909101 CCACCAAAGCCCAGTAATAAGTG No data
Right 1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG No data
1026046489_1026046493 16 Left 1026046489 7:66909089-66909111 CCAGTAATAAGTGAAGAGCTGTC No data
Right 1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026046493 Original CRISPR GTTATATGCAGAAGATGGCA GGG Intergenic
No off target data available for this crispr