ID: 1026047976

View in Genome Browser
Species Human (GRCh38)
Location 7:66921248-66921270
Sequence GCCCGAACTGAGGCGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026047968_1026047976 -1 Left 1026047968 7:66921226-66921248 CCCGGAAACCGCGGTTGCCGGAG 0: 1
1: 0
2: 2
3: 2
4: 108
Right 1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 131
1026047970_1026047976 -9 Left 1026047970 7:66921234-66921256 CCGCGGTTGCCGGAGCCCGAACT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 131
1026047969_1026047976 -2 Left 1026047969 7:66921227-66921249 CCGGAAACCGCGGTTGCCGGAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026047976 Original CRISPR GCCCGAACTGAGGCGGCGGC GGG Exonic
900427283 1:2586514-2586536 GCCCGGATTGAGGAGGCGGGAGG + Intronic
900473486 1:2865662-2865684 GGCCGGACTGAGGCCCCGGCAGG - Intergenic
900538113 1:3188913-3188935 GCCCCAACTGAGGTGGCTGGAGG - Intronic
901066033 1:6495099-6495121 GCCTGACCTGAAGGGGCGGCTGG - Intronic
903596901 1:24502372-24502394 GCCCGAGGAGAGGCGGCCGCAGG - Intronic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
904063056 1:27726164-27726186 GCGCGGGCTGGGGCGGCGGCCGG + Intronic
904482954 1:30805511-30805533 ACCAGAACTGAGGCGGGGGTGGG + Intergenic
905440040 1:37989838-37989860 GCCTGAGCAGAGGCTGCGGCAGG - Intronic
905553149 1:38859754-38859776 GGCCGGACTGTGGCGGCTGCCGG - Exonic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
913186522 1:116374042-116374064 GCCGGAACCGGGGCCGCGGCGGG - Exonic
916108190 1:161445620-161445642 CCCCGAACGGAGGGAGCGGCTGG + Intergenic
916109776 1:161453000-161453022 CCCCGAACGGAGGGAGCGGCTGG + Intergenic
916111363 1:161460411-161460433 CCCCGAACGGAGGGAGCGGCTGG + Intergenic
916112949 1:161467791-161467813 CCCCGAACGGAGGGAGCGGCTGG + Intergenic
919809403 1:201399341-201399363 GCGCCAGGTGAGGCGGCGGCCGG - Exonic
923631154 1:235650100-235650122 GCCCGGGCTGGGGCGGGGGCGGG - Intronic
1063776186 10:9267858-9267880 GCTTGAACTGGGGCGGGGGCGGG - Intergenic
1066464524 10:35640839-35640861 CCCCGCACCGCGGCGGCGGCAGG - Exonic
1074843216 10:117375228-117375250 GCCCGGGCGGAGGCGGTGGCGGG - Exonic
1075441586 10:122484167-122484189 GCCAGAACTGAGGCAGCAGAAGG - Intronic
1076116858 10:127907068-127907090 GCTGGAGCCGAGGCGGCGGCGGG + Exonic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1079443502 11:20538388-20538410 CCCCGAACGGAGGCACCGGCTGG + Intergenic
1081528686 11:43943563-43943585 GCCCGCGCTGAGTCGGCGGCGGG + Intronic
1082023349 11:47553009-47553031 GCAGCAACTGAGGCAGCGGCAGG - Intronic
1084970615 11:72769802-72769824 ACCCGAACTGGGGCTGCTGCTGG - Intronic
1089131842 11:116218517-116218539 TCCAGAACTGAGGCAGGGGCAGG + Intergenic
1089255169 11:117190309-117190331 GCTGGAGCTGAGGCTGCGGCAGG - Intronic
1092523272 12:9294332-9294354 GCCCGCAGTGAGGAGGCGCCGGG + Intergenic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1095440899 12:42238110-42238132 GCCCGGACTGTGCGGGCGGCAGG - Intronic
1096134590 12:49188800-49188822 ACCCGCACTGCGGCGGCGGCGGG + Intronic
1098286362 12:68911351-68911373 GCCCAAACTGCAGCTGCGGCTGG + Intronic
1103565410 12:121812820-121812842 ACCCAAACTAAGGCAGCGGCAGG - Intronic
1104969337 12:132524126-132524148 GCCGAAACTGAGGCTGGGGCAGG + Intronic
1105943643 13:25171587-25171609 GCCGGAGCCGCGGCGGCGGCGGG - Exonic
1110119372 13:71864817-71864839 GCGCGCACGGAGGAGGCGGCGGG - Intronic
1112310506 13:98313805-98313827 GGCCGAGATGAGGAGGCGGCTGG - Intronic
1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG + Intergenic
1124003907 15:25781042-25781064 GACCAACCTGAAGCGGCGGCAGG - Exonic
1126436914 15:48645894-48645916 CCCCGCACCGAGGCGGAGGCTGG - Intergenic
1128887585 15:71302844-71302866 GGGCTAAATGAGGCGGCGGCAGG - Intronic
1138347972 16:56331571-56331593 GCCCGAGAGGAGGCGGGGGCTGG - Intronic
1138619288 16:58198294-58198316 GTCCGACCTGTGGCGGCGGGAGG - Intergenic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1142586850 17:979420-979442 GCCCGAGCCGCGGCGGCGCCTGG - Exonic
1142661965 17:1436801-1436823 GCCGATACTGAGGCGGAGGCAGG + Exonic
1143628449 17:8123838-8123860 GCCAGACCTGAGTGGGCGGCGGG - Intronic
1144317897 17:14081296-14081318 GCCTGAACTGAGGCTGTGGTGGG + Intronic
1145305756 17:21674269-21674291 GCGGGGACTGGGGCGGCGGCGGG + Intergenic
1145962915 17:28897723-28897745 GCCGGAAGTGTGGCGGCGGAGGG + Intergenic
1147795072 17:43036516-43036538 GGCCCAACTGGGGCGGCGCCGGG - Intergenic
1148549994 17:48544544-48544566 GCCGGAACGGCGGAGGCGGCCGG + Exonic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1152363397 17:79842524-79842546 GCCCAAACCGAGGTGGCGTCTGG - Intergenic
1152675289 17:81637001-81637023 GCCGGGGCTGAGGCCGCGGCCGG - Exonic
1154294580 18:13137342-13137364 GCGCGAGCTGTGGGGGCGGCCGG + Intergenic
1155453503 18:25987199-25987221 GCCTGAACTGAGGTGGGGGGTGG - Intergenic
1160358001 18:78244970-78244992 TGCCAAACTGAGGTGGCGGCTGG - Intergenic
1160588735 18:79927895-79927917 GCTCTAGCTGAGGCGGCTGCAGG - Intronic
1160810112 19:1009592-1009614 GCCAGGAATGAGGCGGCAGCCGG + Exonic
1160829198 19:1095074-1095096 ACCCGACCTGAGCCGGCAGCGGG - Intronic
1160864709 19:1251555-1251577 CCCCGAACTGAGCCGGCTGGGGG - Exonic
1160930340 19:1567222-1567244 GCCCAGACAAAGGCGGCGGCGGG + Intronic
1160948074 19:1652535-1652557 GCCGGAGCCGACGCGGCGGCGGG - Intronic
1162909835 19:13842813-13842835 GCCCGGCCCGGGGCGGCGGCCGG - Intergenic
1163484385 19:17577369-17577391 GATCAACCTGAGGCGGCGGCAGG + Exonic
1164598889 19:29548079-29548101 GCCTGAACTGGGGCTGCAGCAGG + Intronic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166375227 19:42324062-42324084 GGGCGAACTCCGGCGGCGGCCGG - Intronic
1168239826 19:55083498-55083520 GCACGAGCGGAGGCGCCGGCAGG + Exonic
925439831 2:3875909-3875931 TCCCAAACTGAGGTGTCGGCAGG + Intergenic
928278276 2:29921515-29921537 CTCCGAACAGAGGCGGCGGGAGG + Exonic
934566844 2:95346223-95346245 GCCCGCGCGGAGTCGGCGGCGGG - Intronic
934738435 2:96702241-96702263 GCCCTCACTGAGGCTGCAGCTGG + Intergenic
937203896 2:120223587-120223609 GCGCGAGCAGAGGCGGTGGCCGG + Intergenic
940762335 2:157751452-157751474 GCCCGAACTCAGGGGAGGGCAGG + Intronic
942151066 2:173076161-173076183 GCCCGCCCGGCGGCGGCGGCCGG + Intronic
948652624 2:239457916-239457938 GCCAGAACACAGGTGGCGGCTGG - Intergenic
1168828847 20:833514-833536 GCCGGGGCTGAAGCGGCGGCAGG + Intergenic
1170443306 20:16399914-16399936 GCCTGAACTGAGGCAGCAGTGGG - Intronic
1171531011 20:25853736-25853758 GCGGGGACTGGGGCGGCGGCGGG + Intronic
1173949382 20:46978410-46978432 GCCGGAACTGAGGCCTCTGCAGG + Intronic
1174836230 20:53857933-53857955 GCCCGAACAGAAGAGACGGCTGG - Intergenic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1175856277 20:62122540-62122562 GCCCAGGCGGAGGCGGCGGCGGG + Exonic
1179667992 21:42925629-42925651 GCCCCAAGTGAGGAGGGGGCAGG + Intergenic
1179947221 21:44686519-44686541 GCCCGACCTGAGCATGCGGCAGG - Intronic
1180675170 22:17581614-17581636 GCTCTTACTGAGGCGGTGGCGGG - Intronic
1182451392 22:30423895-30423917 GCCCAAACTCAGACGGCGTCAGG + Exonic
1182623506 22:31630444-31630466 GCCTGCAGTGAGGCGGCTGCAGG - Intronic
1184101587 22:42343973-42343995 GCCCGGATGGAGGCGGCGGGCGG + Intergenic
954217789 3:49133905-49133927 GCCGGGACTGTGGAGGCGGCAGG - Intergenic
955911544 3:63863822-63863844 GCGCAAGCTGAGGCGGCGGTTGG + Exonic
963160787 3:142149270-142149292 GCCCGCGCTTAGGCGGCGGCCGG + Exonic
968577982 4:1376798-1376820 GCAGGAGCTGAGGCGGCGGCAGG - Intronic
968809351 4:2793035-2793057 GACGGAGCTGCGGCGGCGGCGGG + Intronic
968820180 4:2844058-2844080 GTTCGGGCTGAGGCGGCGGCGGG + Intronic
969641774 4:8402981-8403003 CCCTGAGCTGAGGCGGTGGCTGG - Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
982157288 4:152535458-152535480 CCCCGATGTGAAGCGGCGGCTGG - Exonic
984756870 4:183332713-183332735 GCTCGACCTGGGGCTGCGGCAGG + Intergenic
985497679 5:218677-218699 GCCCGGACCAAGGCGGCGGAGGG - Intronic
985537339 5:472746-472768 GCCCGACCTGCAGCGGCTGCAGG - Exonic
985737645 5:1594121-1594143 GCCCGGACCAAGGCGGCGGAGGG + Intergenic
987282833 5:16427725-16427747 GCTCCAACAGAGGCGGCTGCTGG + Intergenic
994451519 5:99950408-99950430 GCAGGGACTGAGGCAGCGGCAGG - Intergenic
1001402066 5:171451483-171451505 GCCAGAACAGAGGCGGTGGCAGG - Intronic
1010228585 6:73514571-73514593 GTCCCAACTGAGGCTGAGGCAGG - Intergenic
1012887255 6:104859846-104859868 GCGCGAGCAGAGGCGGCGGCGGG - Exonic
1018148808 6:160919672-160919694 GCCTGCACTGAGGCGGCACCAGG + Intergenic
1018950819 6:168377755-168377777 GCCCGAGCTCAGGCGTCAGCCGG - Intergenic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1022091438 7:27110346-27110368 GCGCGGCCTGGGGCGGCGGCGGG + Exonic
1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG + Exonic
1029257800 7:99281076-99281098 CCCCAAGCTGAGGGGGCGGCAGG - Intergenic
1034891928 7:154847821-154847843 GGCTGAAGTGAGGGGGCGGCAGG - Intronic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1035169679 7:157010519-157010541 GCCCGCACGGAGGAGGCGCCGGG - Exonic
1035728987 8:1841854-1841876 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729008 8:1841908-1841930 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729026 8:1841962-1841984 ACCGGAACTGGGGCCGCGGCGGG + Intronic
1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729055 8:1842034-1842056 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1038423058 8:27445947-27445969 GCCCGGACTGAGGAGGCTGCTGG + Intronic
1039921480 8:41896832-41896854 GCTCGTACTGCGGCGGCGGCGGG + Intergenic
1042190046 8:66177315-66177337 GCTCGGACTGCGGCGGCGGCTGG + Exonic
1045269439 8:100649547-100649569 ACCCGACCTGCGGCGGCGGGCGG + Exonic
1049166365 8:141128531-141128553 GCCCGAGCCGAGGCGGGGCCTGG - Intronic
1049759821 8:144326890-144326912 GGCCGACCTGAGGCGGGGCCTGG + Exonic
1056170502 9:83980363-83980385 GCCCGAAGGGAGGCGCTGGCGGG - Intronic
1060106567 9:120876766-120876788 GTCCGAAGTCAGGCTGCGGCAGG - Intronic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1062623661 9:137433651-137433673 GCCCCGACTGAGGCAGCTGCTGG + Intronic
1189407119 X:40735356-40735378 TCCCGCCCGGAGGCGGCGGCGGG - Exonic
1198388139 X:136147717-136147739 CCCCGAGCGGCGGCGGCGGCGGG - Intronic