ID: 1026054145

View in Genome Browser
Species Human (GRCh38)
Location 7:66970329-66970351
Sequence GGATGGACTGAGTGTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026054145_1026054153 14 Left 1026054145 7:66970329-66970351 CCTACCTCACACTCAGTCCATCC No data
Right 1026054153 7:66970366-66970388 GTGCGTGGGACAGTTTTTGCAGG No data
1026054145_1026054151 -1 Left 1026054145 7:66970329-66970351 CCTACCTCACACTCAGTCCATCC No data
Right 1026054151 7:66970351-66970373 CAGGGAATTACGTGTGTGCGTGG No data
1026054145_1026054152 0 Left 1026054145 7:66970329-66970351 CCTACCTCACACTCAGTCCATCC No data
Right 1026054152 7:66970352-66970374 AGGGAATTACGTGTGTGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026054145 Original CRISPR GGATGGACTGAGTGTGAGGT AGG (reversed) Intergenic
No off target data available for this crispr