ID: 1026063335

View in Genome Browser
Species Human (GRCh38)
Location 7:67046266-67046288
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026063335_1026063336 1 Left 1026063335 7:67046266-67046288 CCTTTGGTTCTGCTTGTGGTTGA 0: 2
1: 0
2: 1
3: 9
4: 166
Right 1026063336 7:67046290-67046312 TTTTTAGTTCTGATTGCCTCTGG 0: 2
1: 0
2: 0
3: 21
4: 226
1026063335_1026063341 24 Left 1026063335 7:67046266-67046288 CCTTTGGTTCTGCTTGTGGTTGA 0: 2
1: 0
2: 1
3: 9
4: 166
Right 1026063341 7:67046313-67046335 TATCACGCATTGGGCACACTGGG 0: 1
1: 1
2: 0
3: 1
4: 40
1026063335_1026063337 14 Left 1026063335 7:67046266-67046288 CCTTTGGTTCTGCTTGTGGTTGA 0: 2
1: 0
2: 1
3: 9
4: 166
Right 1026063337 7:67046303-67046325 TTGCCTCTGGTATCACGCATTGG 0: 1
1: 1
2: 0
3: 1
4: 53
1026063335_1026063340 23 Left 1026063335 7:67046266-67046288 CCTTTGGTTCTGCTTGTGGTTGA 0: 2
1: 0
2: 1
3: 9
4: 166
Right 1026063340 7:67046312-67046334 GTATCACGCATTGGGCACACTGG 0: 1
1: 1
2: 1
3: 1
4: 35
1026063335_1026063338 15 Left 1026063335 7:67046266-67046288 CCTTTGGTTCTGCTTGTGGTTGA 0: 2
1: 0
2: 1
3: 9
4: 166
Right 1026063338 7:67046304-67046326 TGCCTCTGGTATCACGCATTGGG 0: 1
1: 1
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026063335 Original CRISPR TCAACCACAAGCAGAACCAA AGG (reversed) Intronic
901492322 1:9602823-9602845 CCAGCCATAAGCAGGACCAAGGG - Intronic
904927881 1:34062725-34062747 TCAAACACCAGCAGAAGCAAGGG - Intronic
907366807 1:53968163-53968185 TAATCCACAAGCAGAACTTAAGG - Exonic
915994726 1:160550851-160550873 ACAACAACAAGCAGAGGCAATGG + Intronic
922367853 1:224882720-224882742 GCAACCACAAAAGGAACCAAGGG - Intergenic
923561868 1:235047712-235047734 TCAACCACAGCCAGACCCAAAGG + Intergenic
1065144239 10:22751838-22751860 TCAACCACAGGTTGAATCAAGGG - Intergenic
1066105800 10:32155747-32155769 TCAACCAGAAGAAGACCCTAAGG - Intergenic
1070501267 10:77074878-77074900 GCAAACACAAGGAGCACCAAGGG + Intronic
1073823452 10:107291800-107291822 TCCACCTCAAGCAGAAGGAAGGG + Intergenic
1074329301 10:112488491-112488513 TCAGCCAGAACCAGACCCAAAGG + Intronic
1074954157 10:118371239-118371261 TGACCAACAAGCAGAAACAAGGG - Intergenic
1075276186 10:121094718-121094740 TCAACCCCAATCAGAGTCAAGGG - Intergenic
1075868010 10:125744194-125744216 ACAACCAAAACCAAAACCAAAGG - Intronic
1077789504 11:5423087-5423109 TAAAGAACAAGCAGATCCAATGG + Exonic
1079638487 11:22774897-22774919 TCAACCAGAATCAGAAAGAAAGG + Intronic
1079744896 11:24113304-24113326 TCAGCCACAAGTAAACCCAAAGG - Intergenic
1079933144 11:26589949-26589971 TTCACCACACACAGAACCAAAGG + Intronic
1080458119 11:32433278-32433300 GGAACCGCAAGCAGACCCAAGGG - Intronic
1080792542 11:35534861-35534883 TCAAACCCAAGCAGGACCAGAGG + Intergenic
1082620710 11:55418151-55418173 TCACCCAGAAGCTGAACAAATGG - Intergenic
1084400598 11:68940774-68940796 TCAACCTCACTCAGAACCATCGG - Intergenic
1084785932 11:71441656-71441678 TTAACGAGATGCAGAACCAAAGG - Intronic
1084883051 11:72185773-72185795 TCAGCCACAGGCAGCATCAATGG - Intergenic
1091777681 12:3195206-3195228 CCACACACAATCAGAACCAATGG - Intronic
1092933327 12:13337789-13337811 CCCACCACAAACATAACCAAAGG - Intergenic
1094139244 12:27163585-27163607 TGTTCCACAAGCAAAACCAAGGG + Intergenic
1094313319 12:29110933-29110955 TGATAAACAAGCAGAACCAAAGG - Intergenic
1096200206 12:49675972-49675994 TCAATCACAAGCAAATCCTAGGG - Intronic
1097363339 12:58682291-58682313 TCACCTACAAGCAGGCCCAATGG + Intronic
1097649917 12:62284682-62284704 TCAATCACAAGCAGAATCAAAGG - Intronic
1097890346 12:64771496-64771518 ACAAGCACAAGCAGGACCAGAGG + Intergenic
1098930860 12:76411548-76411570 TAAACCAAATGCAGAATCAATGG - Intronic
1100363026 12:93895297-93895319 TCACTCCCAAGTAGAACCAAAGG + Intergenic
1100796416 12:98186344-98186366 TCAACCACAAACAGGCTCAAAGG + Intergenic
1101008876 12:100429863-100429885 TCAAACACAAGAATAACCCAAGG + Intergenic
1101268727 12:103119887-103119909 TCAACCAACAGCAGGGCCAAAGG - Intergenic
1105065492 12:133193781-133193803 TCAATCAAAACCAGGACCAAAGG - Intronic
1106160922 13:27200703-27200725 TGCATCACAAGCAGACCCAATGG + Intergenic
1107079663 13:36361329-36361351 TCAAACACAAGCACCACCAGAGG + Intronic
1107424133 13:40275994-40276016 ACTACAACAAGCAGAACCCAGGG + Intergenic
1108477251 13:50832917-50832939 CCATACACAAACAGAACCAATGG + Intronic
1108690574 13:52855962-52855984 TCAACCACAAGCAAATCTAGTGG + Intergenic
1112249568 13:97767343-97767365 TAAACTGCAAGCAGAACAAATGG - Intergenic
1113184214 13:107668373-107668395 TCACCCACAAGCAGGACAACAGG - Intronic
1113274227 13:108710334-108710356 TCAAACAAAAGTAGAACAAAGGG - Intronic
1113985278 13:114309971-114309993 GCAACCACAAGCAGTATCCAGGG + Intergenic
1115446232 14:33493459-33493481 TCAACGACAGGCAGAATGAAAGG + Intronic
1116686606 14:48047885-48047907 TCAGCCAGAAGCAGGAGCAAGGG + Intergenic
1117036208 14:51732336-51732358 ACATTCAAAAGCAGAACCAAGGG + Intergenic
1117518356 14:56525224-56525246 TCAAACACAAACAGAAACAGTGG + Intronic
1117790569 14:59336736-59336758 TCAACTGAAAGCAGAGCCAAAGG + Intronic
1118432657 14:65736415-65736437 GTAACCACAAGCAGAGCTAATGG - Intronic
1118443293 14:65830850-65830872 TCTACCACATTCAGAAACAACGG + Intergenic
1119167682 14:72508820-72508842 TGAACCAGAAGAAGAACCATAGG - Intronic
1119404569 14:74389696-74389718 TCAAACACACTCAGAACAAAGGG + Intergenic
1124219215 15:27834895-27834917 TGAACCACAAGCTAAGCCAACGG + Intronic
1126153319 15:45542473-45542495 ACAAACACATGCAAAACCAAGGG - Intergenic
1129888538 15:79055802-79055824 TCTACCACAATCAGACCCAAAGG + Intronic
1131068157 15:89447617-89447639 TCAGCCACAAGCAGGAACAGGGG + Intergenic
1133661216 16:7919661-7919683 TGCACCACCAGCAGCACCAATGG + Intergenic
1135635421 16:24071576-24071598 CCAATCACAAGTAGAACCACTGG - Intronic
1136122377 16:28147041-28147063 ACAGCCACCAGCAAAACCAAAGG - Intronic
1151006875 17:70448206-70448228 TCAAACACAAGCAGAGAGAATGG + Intergenic
1157458898 18:47866746-47866768 TCAAGCAACAGCAAAACCAAAGG - Intronic
1157581030 18:48774267-48774289 TCGACCAGAAGCAGAACCATGGG + Intronic
1157992816 18:52517877-52517899 TGAACTACAAGCATAATCAATGG - Intronic
1159365471 18:67460886-67460908 TTAACCATAATCAGAAACAAAGG - Intergenic
1159384717 18:67708226-67708248 TAGCCCACAAGCAGATCCAAAGG - Intergenic
1159668572 18:71194914-71194936 TCCACTACAAGCAGAACAAGAGG - Intergenic
1159673204 18:71249378-71249400 TGCACCACAACCCGAACCAAGGG + Intergenic
1160567305 18:79794924-79794946 TCAACAACAATCAGAAGAAAGGG + Intergenic
1161299074 19:3534256-3534278 GCCACCACAAGCAGAAACCAAGG - Intronic
1161930630 19:7337153-7337175 TCCACAGCAAGGAGAACCAAAGG - Intergenic
1162516793 19:11153112-11153134 TCAGCCAGAAGCAGATCAAATGG - Intronic
926877811 2:17503460-17503482 AGAACCAAAAGCAGGACCAAGGG - Intergenic
927292482 2:21418752-21418774 TCTAGCACAATAAGAACCAAAGG - Intergenic
927622472 2:24676431-24676453 TATACCACAGGCAAAACCAAGGG + Intronic
929763437 2:44825119-44825141 TCACACAGCAGCAGAACCAAAGG - Intergenic
931093327 2:58911091-58911113 TCAATCACAGGCAGACACAAAGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
935515023 2:104025549-104025571 TTAACCAGAAGAACAACCAATGG - Intergenic
936500963 2:113066072-113066094 GAACACACAAGCAGAACCAATGG + Intergenic
941308442 2:163898765-163898787 GTATCCACAAGCAAAACCAAAGG + Intergenic
944858084 2:203786911-203786933 TTAAACACAAACAGCACCAAAGG - Intergenic
945636326 2:212356330-212356352 TCAGCCACAGGCAGAGCCAATGG + Intronic
947273924 2:228370291-228370313 TCAACCTCAAGAAGAAACAGGGG + Intergenic
1169037658 20:2466877-2466899 TCAGCCCCAAGGAGAATCAAAGG + Intronic
1169722590 20:8695234-8695256 TCAACCACCAGCATAACAAAAGG - Intronic
1172309929 20:33909862-33909884 TGAACCACAGGCATATCCAAAGG - Intergenic
1175112024 20:56655135-56655157 TCAACAAGATCCAGAACCAAGGG + Intergenic
1175489366 20:59369040-59369062 TCAAGCACAAGCAGGAGCAGGGG - Intergenic
1177154675 21:17489747-17489769 CCAAATACAAGCAGAGCCAAAGG + Intergenic
1179409309 21:41149961-41149983 CCAGCCACAAGCAGAACCCCTGG - Intergenic
1181957932 22:26601820-26601842 TCAAGCACAGGCAGAATCAGAGG - Intronic
949943185 3:9170607-9170629 TCATTCACAATCAGAACCACCGG - Intronic
953213530 3:40897304-40897326 TCAACCACAGGAGGAAACAAAGG - Intergenic
954331916 3:49895765-49895787 GCAGCCACAAGCAGCAGCAAAGG + Exonic
955048073 3:55378589-55378611 TCACCCACAAGGATACCCAAAGG + Intergenic
955230140 3:57091701-57091723 TCCACTACAAGCCGAACAAAAGG + Exonic
957496956 3:81005415-81005437 TCACCCACAATCATAACTAAGGG - Intergenic
960168538 3:114431751-114431773 TTTTCCACAATCAGAACCAAAGG + Intronic
961083846 3:124049557-124049579 TCAACCACACTCAAAACCGAAGG - Intergenic
964499277 3:157330778-157330800 CCAGCCACATCCAGAACCAAGGG + Intronic
965032646 3:163392164-163392186 GCATCCAGAAGCAAAACCAAAGG + Intergenic
966159313 3:176951241-176951263 TCACCCAGAATTAGAACCAAAGG - Intergenic
966493039 3:180550493-180550515 TCAACCCCAAGAAGAAACAGGGG + Intergenic
967064876 3:185906009-185906031 TCAAGAACAAGCAAAACTAACGG - Intergenic
970625627 4:17875800-17875822 TAAGCCACAAGAAGAACCTAAGG - Intronic
971540303 4:27808089-27808111 TAAGCCCCAACCAGAACCAAAGG - Intergenic
974715400 4:65662983-65663005 TCAAACAAAAGTAGAACCTAGGG - Intronic
977471082 4:97443851-97443873 TAAAACATAAGCAGAACCAAAGG + Intronic
979298591 4:119061545-119061567 TTAAGCACAAGCATAGCCAATGG + Intergenic
979781188 4:124652948-124652970 TCTCCCAGAAGCAGAAACAAAGG + Intergenic
980296342 4:130923261-130923283 TCAAACACAAGCAGCAGCATGGG + Intergenic
980948211 4:139345087-139345109 TCAACCTCAAGGTGAGCCAAGGG - Intronic
983491461 4:168394668-168394690 TCAAGCTCAATCAGAATCAAAGG + Intronic
985932458 5:3069176-3069198 AGAAACACAGGCAGAACCAAGGG - Intergenic
987812681 5:22858488-22858510 CCAACCACATGCCCAACCAATGG + Intergenic
987929714 5:24388518-24388540 TAGACCACAAGGAGGACCAAAGG - Intergenic
991599166 5:68335455-68335477 TCAGAAGCAAGCAGAACCAAGGG - Intergenic
993435875 5:87893584-87893606 TCTACCAGAAGCAGAGCCAATGG + Intergenic
994549456 5:101212154-101212176 ACAACCAAAAGAAGAAACAATGG + Intergenic
996271897 5:121616260-121616282 TCCACCACAACAAGGACCAAAGG + Intergenic
998950349 5:147387502-147387524 TCAGCCACAAGCAGCAACACTGG - Exonic
999160847 5:149497513-149497535 TCCACCACAAGTAGACCCTAGGG + Intronic
1004649223 6:17592530-17592552 TCAACCACTTGGAGAAGCAAAGG + Intergenic
1005989855 6:30896101-30896123 TCAACAACAAGCAGAGACAGAGG - Intronic
1007360529 6:41352140-41352162 TCAACCATAAGCAGAAACTCTGG - Intergenic
1008200829 6:48587785-48587807 GCAACCATAAGAGGAACCAAGGG + Intergenic
1008399082 6:51042981-51043003 CCAAACTCAAGCAGAAGCAACGG - Intergenic
1012648235 6:101716778-101716800 ACAACCACAACCACAACAAAAGG + Intronic
1016114806 6:140266985-140267007 CCAAACACAAGCAGAAAAAAGGG - Intergenic
1016619904 6:146096572-146096594 TTAATCACAAGCATAACAAATGG + Intronic
1016834131 6:148460047-148460069 TCTACCACAGACAGAACAAAAGG + Intronic
1017220745 6:151962566-151962588 CAAACCACAACCACAACCAAGGG + Intronic
1019091306 6:169537141-169537163 TCAACCACTAGGAATACCAAGGG - Intronic
1019692709 7:2425546-2425568 TCAGCCACATCCAGAAACAATGG - Intronic
1020385382 7:7595280-7595302 TTAGCAAGAAGCAGAACCAAAGG - Intronic
1020771642 7:12403391-12403413 ACAACCAAAAACAGAACCAAGGG + Intronic
1021215128 7:17906783-17906805 TCAACCAACAGAAGAGCCAAAGG + Intronic
1022166526 7:27769813-27769835 CCAACTGCAAGCAGAACAAAAGG + Exonic
1022827711 7:34033398-34033420 GCAACCACATGTAGTACCAATGG + Intronic
1026063335 7:67046266-67046288 TCAACCACAAGCAGAACCAAAGG - Intronic
1026123956 7:67563160-67563182 CCAACCCCAAGCAGATCCACAGG - Intergenic
1026715008 7:72781231-72781253 TCAACCACAAGCAGAACCAAAGG + Intronic
1028649341 7:93133561-93133583 TCATCCACAAGGAGAAGCACAGG + Exonic
1030407600 7:109133589-109133611 CCATCCACAAGCAGAAATAAAGG + Intergenic
1034548792 7:151807261-151807283 TCAGCCACCAGCAGACCCATGGG + Intronic
1036598931 8:10240990-10241012 TCATGCACAAGCAGGACCAGAGG - Intronic
1037295956 8:17400576-17400598 GCAACGACAAGAAAAACCAAGGG - Intronic
1038708934 8:29922628-29922650 ACAACCACAGGCCGAACCACAGG + Intergenic
1039709638 8:40042800-40042822 TAAAGCAAAAGCAGAACCAGAGG - Intergenic
1040834771 8:51719957-51719979 CCAAATACAAGCAGAGCCAAAGG + Intronic
1041220644 8:55648125-55648147 TCAAGCAGAAGCAGGACCACTGG + Intergenic
1048365373 8:133733555-133733577 CCAGCCACCAGCAGGACCAAGGG - Intergenic
1050157028 9:2678738-2678760 TCAACCCCCAGCAAAACAAACGG + Intergenic
1050686758 9:8179334-8179356 TAAAACAAATGCAGAACCAAAGG - Intergenic
1052586485 9:30435551-30435573 TCAGCTACAAACAGATCCAATGG + Intergenic
1057314446 9:93959464-93959486 CCAAGGACAATCAGAACCAAAGG - Intergenic
1057396560 9:94686011-94686033 TCATCCACAAATAGAACCCAGGG - Intergenic
1057812911 9:98271353-98271375 TGAACCACAACCTGAATCAAAGG - Intergenic
1060385515 9:123223905-123223927 TCTGACACAGGCAGAACCAAAGG + Intronic
1060711727 9:125872436-125872458 CCAACCACTAGCAGAAGGAAAGG + Intronic
1060818229 9:126646649-126646671 TCCACCAGAAGTAGAACCCAGGG - Intronic
1062020218 9:134315856-134315878 GCATCCCCAAGAAGAACCAAGGG - Intergenic
1186333794 X:8564663-8564685 TCCACCACATGCAGAAGGAAGGG + Intronic
1188203940 X:27329094-27329116 TAAGCCACAAACAGATCCAAAGG + Intergenic
1188885405 X:35543788-35543810 GCAAGCATTAGCAGAACCAAAGG - Intergenic
1190001480 X:46692370-46692392 CCCACCACAAACAGAACCACAGG + Intronic
1192109133 X:68346392-68346414 TCAACCAGAAGCAAAACAACTGG + Intronic
1192799335 X:74450796-74450818 CCAACCACTACCAGAGCCAAGGG - Intronic
1195625723 X:107004267-107004289 ACAACAACAAAAAGAACCAATGG + Intergenic
1195626862 X:107012879-107012901 TTCAGCACAAGCAGGACCAAAGG + Intergenic
1196045706 X:111254341-111254363 GCAACCACCAGCTGACCCAAGGG - Exonic
1197219991 X:123903136-123903158 TCACAAACAATCAGAACCAAAGG + Intronic
1197395783 X:125924900-125924922 ACAAACACAATCAGAAACAATGG - Intergenic
1199201073 X:145089614-145089636 TCAAACACAAACAAACCCAACGG - Intergenic