ID: 1026063393

View in Genome Browser
Species Human (GRCh38)
Location 7:67046871-67046893
Sequence CTTTCTCTAGTGAAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026063388_1026063393 26 Left 1026063388 7:67046822-67046844 CCCTTATGACTGACTCTGGGGTT 0: 2
1: 0
2: 0
3: 9
4: 153
Right 1026063393 7:67046871-67046893 CTTTCTCTAGTGAAGGGACAGGG 0: 1
1: 0
2: 2
3: 14
4: 210
1026063389_1026063393 25 Left 1026063389 7:67046823-67046845 CCTTATGACTGACTCTGGGGTTG 0: 2
1: 0
2: 0
3: 15
4: 129
Right 1026063393 7:67046871-67046893 CTTTCTCTAGTGAAGGGACAGGG 0: 1
1: 0
2: 2
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026063393 Original CRISPR CTTTCTCTAGTGAAGGGACA GGG Intronic
900946164 1:5832432-5832454 CCTTCTCCAGGGAAGGGAGAAGG + Intergenic
901327750 1:8379123-8379145 CTGGCTCGCGTGAAGGGACACGG + Intronic
904835691 1:33334285-33334307 CTCTCTCTCGTGCAGAGACAGGG - Exonic
905205961 1:36342954-36342976 CTTTCTCCAGTGCAGGGAATGGG + Intronic
905431856 1:37930508-37930530 CAGTCTCTTGTGAAGGGGCAAGG + Intronic
907105886 1:51882270-51882292 GTTTCTCTAAAGAAGGGAAATGG + Intergenic
908874307 1:68652897-68652919 CTTTCTTATGAGAAGGGACAAGG + Intergenic
910839970 1:91551863-91551885 CCTATTCTAGTGAAGGGAGATGG + Intergenic
914523642 1:148440428-148440450 CTGACTCTAGGGATGGGACATGG + Intergenic
915999689 1:160603134-160603156 CTTTCTCTTGTCAATGGACCAGG + Intergenic
916981048 1:170137407-170137429 CTATCTCTAGAGATGGGAGAGGG + Intergenic
917787505 1:178474391-178474413 CTTTCTTTATTGAGGGGATAAGG - Intronic
921430347 1:215058183-215058205 ATTTATCTAGTGAAGGGGCATGG - Intronic
921510590 1:216022914-216022936 GTTTATCCAGAGAAGGGACATGG + Intronic
921789180 1:219270304-219270326 CTCTCTCTGCTGAAGAGACAGGG + Intergenic
924684267 1:246271558-246271580 CTTTCTCCATTGAAGGGTCTTGG + Intronic
1067363711 10:45605265-45605287 CATTCTCTAAAGAGGGGACACGG - Intergenic
1068544656 10:58332224-58332246 ATTAGTCTAGTGGAGGGACATGG - Intergenic
1069253926 10:66308925-66308947 CTTACTCTACTTAAGGGAAATGG + Intronic
1069373053 10:67767263-67767285 CTTCCTCTAGTGAGGGGACAAGG - Intergenic
1069821216 10:71229812-71229834 CTTACTCAAGCCAAGGGACACGG - Intronic
1069886115 10:71624772-71624794 CTTCCTCTATAGAAAGGACAGGG - Intronic
1069970246 10:72161794-72161816 CTTTCTCTATTGAATGGTCTTGG - Intronic
1072310490 10:94149713-94149735 CTTTCTCTATGGAAGGGAATTGG - Intronic
1072557775 10:96536790-96536812 TTTTCTCTTTTGAAGAGACAGGG + Intronic
1072858075 10:98970709-98970731 CTTTCTCTCATGAAGTCACAGGG - Intronic
1074353352 10:112759221-112759243 CTTCCTCTGGTGAAGGGTCCTGG - Intronic
1074939739 10:118223125-118223147 CTGTCTCTAGCAAACGGACAAGG + Intergenic
1075539924 10:123303748-123303770 ATTTATCTAATGAAAGGACATGG + Intergenic
1076812623 10:132896993-132897015 CTTTCCCTAGTGAATGGTCTTGG - Intronic
1080942612 11:36936823-36936845 CTGTCTCTAGTTAGGGGAGAAGG - Intergenic
1082821084 11:57545138-57545160 CTTTCCCTAAGAAAGGGACAAGG - Intronic
1084471987 11:69367812-69367834 CCTTCTCTAGTGAGGGGAAGGGG - Intergenic
1084515293 11:69634665-69634687 CTTGCTATAGGGAAGGGAGAGGG - Intergenic
1084990371 11:72917347-72917369 CTTTCTCTATTGAATAGTCATGG + Intronic
1085863605 11:80262198-80262220 CTCTCTCTAGGCAAAGGACAAGG - Intergenic
1086888005 11:92225694-92225716 CTTTCGCTAGGAAAGGGAAAGGG + Intergenic
1088336015 11:108704811-108704833 CTTTTTCTAGTCAACAGACAGGG - Intronic
1089441136 11:118518254-118518276 CTTTTTCCATTAAAGGGACAGGG - Intronic
1089687915 11:120168806-120168828 GTCTCTCTACTGAAGGGACTTGG - Intronic
1091478435 12:800719-800741 CATTCTCAAGTGAATGGTCAGGG + Intronic
1091556687 12:1579074-1579096 CTTTCTTTAGGGAAACGACATGG + Intronic
1091604605 12:1939426-1939448 CTTTTTCTTGTGAAGAGAAAGGG - Intergenic
1091644831 12:2265530-2265552 CTATCTGTAATGAAGGGACAGGG - Intronic
1092120787 12:6042313-6042335 CTGTCCCTTGTGAAGGGGCAGGG - Intronic
1093406627 12:18812689-18812711 CTTCCCCTAGGGAAGGGTCAAGG - Intergenic
1094395951 12:30006159-30006181 CTCTCTCTAGTTAAAGGACAAGG + Intergenic
1095887865 12:47207488-47207510 CTTTCTCTCCTGATAGGACAAGG + Intronic
1096449905 12:51730290-51730312 CTTTCTCCATTGAAGTGACTTGG + Intronic
1096513193 12:52143225-52143247 CTCTGGCTAGTCAAGGGACATGG - Intergenic
1097454397 12:59779016-59779038 TTTTCTCTATTGAAGAGAAAAGG + Intronic
1098631085 12:72722026-72722048 CTTTCTTTACTGCAGGGCCATGG + Intergenic
1104611996 12:130236487-130236509 CTTTCAGTGGTGAAGGGTCAAGG - Intergenic
1105500338 13:20966295-20966317 CTTTCTCTAGCCAAAGGACGAGG + Intergenic
1105886180 13:24643936-24643958 CTTTCTCTTGTGAAAAGGCAAGG - Intergenic
1107050212 13:36038982-36039004 CTTTCTTTAGTCATAGGACATGG - Intronic
1107958815 13:45541777-45541799 CTTTCTCGAGTGAAGGCTCAGGG - Intronic
1108857768 13:54816655-54816677 CTTTCTCTAGTCAGTGTACATGG - Intergenic
1111686812 13:91512527-91512549 CTTTGCCAAGTGCAGGGACATGG - Intronic
1113440974 13:110327580-110327602 CTTTCTATAGTGAAGAGATTGGG + Intronic
1114568165 14:23647477-23647499 CTTTCTCTACTGCAGGGCCTGGG - Intergenic
1115181865 14:30636488-30636510 CTTTCCCTAGTGAATGGTCTTGG + Intronic
1115234570 14:31196368-31196390 CCTTCTCCAGTAAAGGGTCAGGG + Intronic
1116133597 14:40891742-40891764 CTGTGTGTAGTGTAGGGACATGG - Intergenic
1117726195 14:58676838-58676860 CTCTCCCTAGAGAAGGGAAATGG - Intergenic
1124588391 15:31032079-31032101 CATTCTTTAGTACAGGGACATGG - Intronic
1125409407 15:39389698-39389720 CTTACTGTAGTGCAGGGACCTGG - Intergenic
1125730000 15:41887761-41887783 CATTGTCTAGGGAAGGGAAAGGG + Intronic
1126728173 15:51654313-51654335 CCTTCTCTATTGAATGGACTTGG + Intergenic
1127236971 15:57064472-57064494 CTTTCTCTAGTAAACTGACGAGG + Intronic
1127596567 15:60488191-60488213 CTGTCTCTAGTGAAGGGTCTAGG - Intergenic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1130619110 15:85442829-85442851 ATTTCTCTTGAGAAGGGAAAAGG + Intronic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1131728771 15:95256536-95256558 CTGTCTCTAGCCAAAGGACAAGG - Intergenic
1133180032 16:4047419-4047441 GTTTCTCTAGTTAAGGGCCTGGG + Intronic
1134197865 16:12172752-12172774 CATTCTCGATTTAAGGGACATGG + Intronic
1135837005 16:25835538-25835560 TTTTCTCTATTGATGGCACATGG - Intronic
1137520078 16:49185339-49185361 CATTCTCTTGTCAATGGACATGG + Intergenic
1139468861 16:67167705-67167727 TTTTCTCTGGTGCAGGGAGAAGG + Exonic
1139730892 16:68944373-68944395 CTTTCCCAACTGAAGGGAAAAGG + Intronic
1142847425 17:2689015-2689037 CTACCTCGAGTGAAGAGACAGGG + Intergenic
1143907564 17:10221463-10221485 CTTTCTCCAGTGGAGGGGCAAGG + Intergenic
1144384701 17:14738432-14738454 GTTTCTCCAGTGACGGGACTGGG - Intergenic
1147047707 17:37767023-37767045 CAGTCTCTAGTGAAGGGATTTGG - Intergenic
1147728872 17:42584479-42584501 CTTTTACTAGTGAAGAGACCAGG + Intronic
1149162166 17:53707240-53707262 CTTTCTCTAGTGCAATGTCATGG + Intergenic
1149645924 17:58241703-58241725 CTAACTCTAGAGAAGGGGCAAGG - Intronic
1149853162 17:60053910-60053932 CCTTCTCTAGTACAGGGCCAGGG - Intronic
1150906326 17:69341926-69341948 CTTGCTGAAGTGTAGGGACATGG + Intergenic
1151995040 17:77603121-77603143 CTTTTCCTTGTGAAGGGAGAGGG + Intergenic
1152499232 17:80697151-80697173 CTTTCTGCAGAGAGGGGACATGG + Intronic
1155267182 18:24105652-24105674 CTTTCTCTGGTGTAAGGGCAAGG - Intronic
1155642561 18:28037004-28037026 CTTTCTCTAAAGAAGGAACTTGG + Intronic
1156086815 18:33416041-33416063 CTTTCTTTAGTCAAGAGACCAGG + Intronic
1159820584 18:73137456-73137478 CTTTCTTTACTGAAGGGGAAAGG + Intergenic
1160036931 18:75310212-75310234 CTTTCTTTATTGACTGGACATGG - Intergenic
1160238335 18:77103704-77103726 AATTCTCTAGTGTAGAGACAGGG + Intronic
1161805282 19:6439990-6440012 CTACCCCTAGGGAAGGGACAAGG - Intronic
1163155449 19:15437647-15437669 CTTTCTCTTTTTAAGAGACAGGG - Intronic
1164488937 19:28689276-28689298 CTTTGTCTAGTCAAAGGACTAGG + Intergenic
1165113573 19:33515570-33515592 CTTTCCTGAGTGAAGGGAAAGGG - Intronic
1165229427 19:34377653-34377675 CTTTCTCCAGGGATGGGACCTGG + Intronic
1165287001 19:34850937-34850959 TTTTCTCTAGTGAAAGAACCAGG - Intergenic
1167515910 19:49923100-49923122 CTGCTTCTACTGAAGGGACAAGG + Intronic
925609222 2:5690869-5690891 ATTTCTCTGGTGAAGGGATCCGG + Intergenic
926493810 2:13558837-13558859 CTTGCTCTAGTGAAGCCTCAGGG + Intergenic
928029121 2:27763953-27763975 ATTTCTCAAATGAATGGACAAGG - Intergenic
928904875 2:36357268-36357290 CTTTCTCTCCTGAAAGGAAAGGG + Intronic
930694643 2:54399113-54399135 CTCTCTTCTGTGAAGGGACATGG - Intergenic
931979755 2:67681978-67682000 CATTGTCATGTGAAGGGACATGG - Intergenic
934511119 2:94945194-94945216 ATTTTTCTAGTGCATGGACATGG - Intergenic
934753907 2:96811952-96811974 CTGTCTCTTGTGATGGGACAAGG + Intergenic
938199117 2:129358475-129358497 TTTTCTCTTGTGAAGTCACAGGG - Intergenic
938945539 2:136208805-136208827 CTTTGTAAAGTGAAGGGACTTGG + Intergenic
940169831 2:150816364-150816386 CCTTCTCTTGGGGAGGGACAGGG - Intergenic
940492301 2:154378330-154378352 TTGTCTCAAGTGAAGGCACAAGG - Intronic
941302815 2:163825427-163825449 CTTCCTCTAGTGAAGGTGGAAGG + Intergenic
942862547 2:180633004-180633026 TTCTCTCTAGTAAAGTGACAGGG + Intergenic
943171006 2:184399734-184399756 CTTTCTCTTTTTAAGGGACCAGG + Intergenic
943856882 2:192807265-192807287 CATTCTCTTGTCAATGGACAAGG + Intergenic
944661992 2:201928963-201928985 CTTTCTCCAGTGAAGGGAGGGGG + Intergenic
948518749 2:238522603-238522625 GTTTCTCAAGTGAAGGAAAAAGG - Intergenic
1168966475 20:1901537-1901559 CCTTCTCTAGTATGGGGACAGGG - Intronic
1169630610 20:7626467-7626489 ATTTCTCTAATGTAGGGGCAGGG - Intergenic
1169660512 20:7973582-7973604 CTTTGTCTTCTGAGGGGACAGGG - Intergenic
1169744380 20:8928613-8928635 CTTCCTCCAGTCAAGGGAAAAGG - Intronic
1170718248 20:18851046-18851068 CTTTCTCTATTTTAGAGACAAGG + Intergenic
1172428915 20:34874603-34874625 CTTACCCTAGTGAGGAGACATGG - Intronic
1172881870 20:38206279-38206301 CTTTCTCCATTGAATGGACTTGG + Intergenic
1177996627 21:28107773-28107795 CTGTCTCTAGTGAAAGTACCAGG - Intergenic
1178177535 21:30120257-30120279 CTTTCACTAGTGAAGTGAAGTGG - Intergenic
1178578142 21:33813657-33813679 CTTTCTACAGTGAAAGAACAAGG - Intronic
1181029721 22:20143864-20143886 TTTTCTCTGGGGACGGGACAGGG + Intronic
1181513546 22:23399454-23399476 TTTTCTCTGGGGACGGGACAGGG - Intergenic
1181944071 22:26501892-26501914 CTTTCTCAAGTCAAGGTACAGGG - Exonic
1182625553 22:31643303-31643325 CTTTCTCTATTGAATGGTCTTGG - Intronic
1183010684 22:34944242-34944264 CCTTCTCTAGTGGAGGAACCAGG - Intergenic
951220494 3:20063978-20064000 CTTTCTCTATTGAATGGTCTTGG + Intronic
951664841 3:25111481-25111503 CCATCTCTTGTGAAGGGGCATGG - Intergenic
952113173 3:30148391-30148413 CTAGCTCTGGTGAAGGGAAAAGG + Intergenic
952927584 3:38332626-38332648 CTGTCTCTAGTAAAAGTACAAGG + Intergenic
953783967 3:45896700-45896722 CTTTCTCAAGTGTGGGGCCAAGG + Intronic
954400002 3:50314525-50314547 CTTTCACTTGGGCAGGGACATGG - Intergenic
955824288 3:62928874-62928896 TTTTCTCTAGTTCAGGGGCAGGG + Intergenic
956327279 3:68067906-68067928 CTTACTCTAATGAAGGAACTAGG + Intronic
957278882 3:78124732-78124754 CTTACACTATTGATGGGACATGG + Intergenic
961668304 3:128507820-128507842 CTTTCTCCTGTGAATGGACCTGG - Intergenic
963680873 3:148374909-148374931 CTTCCTCTAGAGCATGGACAAGG - Intergenic
964524904 3:157607840-157607862 CTCTCACTACTGCAGGGACAGGG - Intronic
966197132 3:177324899-177324921 CTTTATCTAGTGAAGTGACCCGG + Intergenic
966243321 3:177778725-177778747 CATTCTCTACTGAAAGAACAAGG + Intergenic
967473186 3:189886765-189886787 GTTTCTTTAGTGTAGGGATAAGG + Intronic
969175033 4:5392004-5392026 ATTTATGTAGAGAAGGGACAGGG + Intronic
971462228 4:26912513-26912535 ATTCCTCTAGTGAAGGCAAAGGG + Intronic
971847594 4:31940602-31940624 CTTTGTCTTTTGAAGAGACAGGG + Intergenic
972299381 4:37770817-37770839 CTTTCTCTTTTTTAGGGACAAGG + Intergenic
974022500 4:56704529-56704551 TTTTTTCTTGTGAAGGAACAGGG - Intergenic
975139807 4:70907522-70907544 CTTTTTCTTGTTAAGAGACAGGG + Intronic
975330103 4:73103017-73103039 CTATCTCTAGTGAAAAAACAAGG + Intronic
975869072 4:78758133-78758155 CTTTCTCTAGCCAAAGGACCAGG - Intergenic
976548637 4:86367606-86367628 CTTTCTCAAGTGAGGGTACAGGG - Intronic
979135136 4:117102081-117102103 CTTTGTCAAGTGATGGTACAGGG - Intergenic
980430599 4:132688978-132689000 CTTTCTCTACTAAAGGAACTAGG - Intergenic
988658375 5:33237424-33237446 CTTTCTCTACTGCAGTGCCATGG - Intergenic
989984761 5:50685502-50685524 CTGACTCTAGAGATGGGACATGG - Intronic
992092775 5:73333412-73333434 CTGTCTCTAGCCAAAGGACAAGG - Intergenic
993921193 5:93805298-93805320 CTTTATATAGTGAAGGAGCAAGG - Intronic
996858424 5:128037055-128037077 TTTTTTCTAGTGAAAGGAGATGG + Intergenic
998278827 5:140784639-140784661 CTTTCTCTAGACAAAGGACCAGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
998923697 5:147099281-147099303 TTATCTCTAATGAAGGGACCAGG - Intergenic
1000184941 5:158850389-158850411 CTTTCACAAGGGAAGGGACTGGG - Intronic
1001705454 5:173738066-173738088 CTATGTCCAGTGAATGGACAGGG + Intergenic
1004085779 6:12447653-12447675 CTTCCACTAGGGAAGGGAGAGGG + Intergenic
1004409855 6:15370842-15370864 CTTTCTCAACTGTAGGGTCATGG - Intronic
1005152742 6:22771552-22771574 CTTTCTCTGGGGAGGCGACATGG + Intergenic
1005618837 6:27601629-27601651 CTTTCTTTGGTGATGGGAGAAGG - Intergenic
1005667016 6:28068045-28068067 CTTTCTCTAGCCAAAGGACCAGG + Intergenic
1006957896 6:37892540-37892562 CTTTTTCTAGTGAAGGTAGAAGG - Intronic
1007705228 6:43786810-43786832 CTTTCCCTGGCTAAGGGACAGGG - Intergenic
1008784323 6:55147314-55147336 CTCTTTCTAGTGAATGTACAAGG + Intronic
1009328293 6:62382039-62382061 CTTTTTCTAGTGATGTGATATGG - Intergenic
1010047547 6:71464114-71464136 CTTTCTCAAGTCAAGGGACAGGG - Intergenic
1010749871 6:79606094-79606116 CTCTTTCTAGAGATGGGACATGG + Intergenic
1011170619 6:84500638-84500660 CATATTCTAGTGGAGGGACAGGG - Intergenic
1011462741 6:87622663-87622685 CTGTATCCAGGGAAGGGACATGG - Intronic
1012493525 6:99809391-99809413 CTTTATTTAGTGAAAGGTCATGG + Intergenic
1018619727 6:165718483-165718505 CTGTGTGTAGTGAACGGACAAGG + Intronic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1026063393 7:67046871-67046893 CTTTCTCTAGTGAAGGGACAGGG + Intronic
1027742941 7:82035805-82035827 CTTCCTCTAGTAAAGGAATATGG - Intronic
1029938142 7:104450409-104450431 CTTTGTTCAGTGCAGGGACATGG + Intronic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1034922876 7:155098443-155098465 CTTTCTGAAGAGAGGGGACAAGG + Intergenic
1035851544 8:2923897-2923919 ATTTTTCTAAGGAAGGGACAAGG + Intergenic
1036428437 8:8667541-8667563 CTCTCTCTAGCTAAAGGACAAGG - Intergenic
1039800199 8:40947816-40947838 CCTTCTCTAGTTATGGCACATGG - Intergenic
1042112554 8:65396095-65396117 CTTTCTCTGGAGAAAAGACAGGG + Intergenic
1043258174 8:78161280-78161302 CTATTTCTAATGTAGGGACATGG + Intergenic
1045946536 8:107802622-107802644 CCTTCCCTATTCAAGGGACATGG - Intergenic
1047767104 8:127998977-127998999 CTTTCTCCAGTAAAATGACAGGG - Intergenic
1048908002 8:139106874-139106896 CCTTCAGTAGTGAAGGCACATGG - Intergenic
1052245038 9:26324154-26324176 ATTTCTCTGAAGAAGGGACATGG - Intergenic
1052421631 9:28250496-28250518 CCTTTTCTAGTGAAAGGACCAGG + Intronic
1057389034 9:94627754-94627776 CATTCTCTAGGGATGGGAAAAGG + Intronic
1057470964 9:95355853-95355875 CTTTCACTTGTGGAGGGGCAGGG + Intergenic
1060607563 9:124930172-124930194 CTTACGTTAGAGAAGGGACAGGG - Intronic
1061960597 9:133987052-133987074 ATTTCTCGAATGAAGGCACAAGG + Intronic
1062292982 9:135805688-135805710 CTTCCTCTATTGAAGGAGCAAGG + Intergenic
1062438000 9:136555359-136555381 CTTTCTTTGGAGAAGGGACTAGG - Intergenic
1062719887 9:138034541-138034563 CTCTCCCTAGTGAAAGGACTAGG - Intronic
1186714730 X:12239529-12239551 CATTATCTAGAGAAGGGAGAGGG + Intronic
1186897849 X:14022393-14022415 TTTTCTCCTGTGAAGAGACAGGG - Intronic
1189182049 X:39013758-39013780 ATTTTTCTAGTGCAGGGACTTGG - Intergenic
1190957848 X:55213523-55213545 TTTTCTCTGGTGAAGTCACAAGG + Intronic
1190991112 X:55551636-55551658 CTTACTCTAGCCAAGGGACCTGG + Intergenic
1193203862 X:78724884-78724906 CTTTCTCTTGTGAAGGCTCAAGG + Intergenic
1194031693 X:88824877-88824899 CTTTCTCTTGTGAAGTCACCTGG - Intergenic
1194830033 X:98612314-98612336 CTTACTCCAGTGAATGGAAAAGG - Intergenic
1195695139 X:107661376-107661398 CTCTCTCTAGGGAAAGGACCAGG + Intergenic
1196679270 X:118454328-118454350 CTTTCCCTAATGAAGGTGCATGG - Intergenic
1196928039 X:120653360-120653382 CTCTCTCTAGTGAGAAGACAGGG - Intergenic
1198330295 X:135616735-135616757 CTTCCACTATGGAAGGGACAGGG - Intergenic
1198336632 X:135672264-135672286 CTTCCACTATGGAAGGGACAGGG + Intergenic
1198363019 X:135914519-135914541 CTTCCACTATGGAAGGGACAGGG - Intergenic
1202136509 Y:21670949-21670971 CTGTCTCAAATAAAGGGACAAGG - Intergenic