ID: 1026067669

View in Genome Browser
Species Human (GRCh38)
Location 7:67089371-67089393
Sequence CCCCACCAGATGCCCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 2, 1: 1, 2: 0, 3: 26, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067669_1026067673 -6 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG 0: 2
1: 1
2: 0
3: 26
4: 263
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG 0: 2
1: 1
2: 2
3: 24
4: 234
1026067669_1026067676 7 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG 0: 2
1: 1
2: 0
3: 26
4: 263
Right 1026067676 7:67089401-67089423 CTGGTAAAGGTCGAAGCGCTGGG 0: 2
1: 1
2: 1
3: 2
4: 39
1026067669_1026067675 6 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG 0: 2
1: 1
2: 0
3: 26
4: 263
Right 1026067675 7:67089400-67089422 GCTGGTAAAGGTCGAAGCGCTGG 0: 2
1: 1
2: 2
3: 3
4: 30
1026067669_1026067678 28 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG 0: 2
1: 1
2: 0
3: 26
4: 263
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65
1026067669_1026067677 12 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG 0: 2
1: 1
2: 0
3: 26
4: 263
Right 1026067677 7:67089406-67089428 AAAGGTCGAAGCGCTGGGTGCGG 0: 2
1: 1
2: 1
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067669 Original CRISPR CCCCACCAGATGCCCTGCAC TGG (reversed) Intronic
900147767 1:1165893-1165915 CCACACCAGGTCCCCTGCCCTGG - Intergenic
900173406 1:1281469-1281491 CCCCACCCCACCCCCTGCACCGG + Exonic
900218472 1:1494802-1494824 CCCCACTAGGTGCCGTGCTCAGG - Intronic
900470763 1:2853866-2853888 CAGGACCAGATGCCCTACACAGG - Intergenic
900500281 1:3001164-3001186 CCCCTCAAGATCCCCTTCACAGG - Intergenic
900635759 1:3664243-3664265 CCCTACCAGAGGCGCTGCATTGG + Intronic
901421104 1:9151776-9151798 CCCCTCCGGATGCCGTGGACCGG - Intergenic
901616174 1:10541478-10541500 CGCCCCCAGAGGCTCTGCACTGG - Intronic
901640215 1:10689244-10689266 CCCCACCCAATCCCCTGCTCAGG + Intronic
901733765 1:11299108-11299130 CCCCAGGAGAGGCCCTGCCCTGG + Intergenic
903236351 1:21953040-21953062 CCCCACCAGATCTCCTCCTCTGG + Intergenic
904213153 1:28898801-28898823 CTGCACTAGATGCCCTGCCCTGG + Intronic
904314880 1:29653609-29653631 ACCCATCAGTTCCCCTGCACTGG + Intergenic
904417613 1:30372810-30372832 CCCCACCAAATGCTCTACCCAGG - Intergenic
904533134 1:31182093-31182115 CCCCGCCCCAGGCCCTGCACGGG - Intronic
904598964 1:31663428-31663450 CTCCCCCAGATGCCCTGGCCAGG - Intronic
904841327 1:33373693-33373715 TCCCAGTTGATGCCCTGCACTGG + Intronic
905016988 1:34784749-34784771 CCCCACCAGGCGCCATGGACTGG + Exonic
905168583 1:36097694-36097716 CCCCACCAGATGCCTGGTCCAGG + Exonic
907458614 1:54592173-54592195 CACCAACAGAGGCCCTGCAGAGG - Intronic
908908785 1:69047865-69047887 CCCCATCACATGCCCTGCGAGGG + Intergenic
909818548 1:80027995-80028017 CCCCATCATATGCCCTGCGAGGG + Intergenic
909836441 1:80260792-80260814 CTGCACCAGATTCTCTGCACAGG - Intergenic
909863053 1:80632993-80633015 CCCCATCACATGCCCTGCAAGGG + Intergenic
910477256 1:87620412-87620434 CCCCATCACATGCCCTGCAAGGG + Intergenic
912174784 1:107141552-107141574 CCCCACCCGCTGCGATGCACAGG + Intronic
912701026 1:111878411-111878433 CCACAGCAGGTGCCCTGGACAGG - Intronic
914977219 1:152377841-152377863 CCCCATCACATGCCCTGCAAGGG - Intergenic
918078342 1:181187503-181187525 ACCCAGCAGATGCACTTCACTGG - Intergenic
921290386 1:213651278-213651300 CCCCACCAGGTGCCCAGCCCAGG - Intergenic
1063009636 10:2009839-2009861 ACCTATCAGATGCCCTGCTCTGG + Intergenic
1063205870 10:3830134-3830156 CCCCACCACACCCCCTGCAGAGG - Intergenic
1063463236 10:6227603-6227625 CCCCACCACATGCCCGACACTGG - Intronic
1066471438 10:35701797-35701819 CCCCACCAGGTGCCATGTCCTGG + Intergenic
1067223352 10:44359712-44359734 CCCCACCAGCTGTCCTGCCAGGG - Intergenic
1068623479 10:59212125-59212147 CACCATGTGATGCCCTGCACTGG + Intronic
1069877444 10:71571862-71571884 CCCCACCCGCACCCCTGCACAGG + Intronic
1069896241 10:71681897-71681919 CCCCAGAAGTTGCCCAGCACTGG - Intronic
1070560072 10:77559536-77559558 CACCACCAGCTGTCCTCCACTGG + Intronic
1070713782 10:78702708-78702730 CCCCGCCTCCTGCCCTGCACTGG - Intergenic
1072042040 10:91616301-91616323 TCCCACCACATGTCTTGCACAGG - Intergenic
1074875113 10:117607608-117607630 CCCAAGCAGAGGCCCTGAACAGG - Intergenic
1075410691 10:122225853-122225875 CCCCTCCACATGCCCTGCTGGGG - Intronic
1075852762 10:125602504-125602526 CCCCATCTGATTCCCTCCACTGG + Intronic
1076058668 10:127395990-127396012 CTCCATTAAATGCCCTGCACAGG - Intronic
1076221268 10:128734909-128734931 CCCACCCGGCTGCCCTGCACCGG - Intergenic
1076452587 10:130567027-130567049 CCACCCCAGAGCCCCTGCACGGG - Intergenic
1076843363 10:133057338-133057360 CCCCAACCCATGCCCTTCACAGG + Intergenic
1076871756 10:133198090-133198112 CCCCACCAGAAGCCTTGGAGGGG - Intronic
1077088434 11:766341-766363 CCCCAGGAGGAGCCCTGCACTGG - Intergenic
1077406371 11:2384261-2384283 CCCCACAAGATGCTCTGCTGGGG - Intronic
1082946951 11:58771087-58771109 CCCCACATCATGCCCTGCATTGG - Intergenic
1084205935 11:67592980-67593002 CCCCATCACATGCCCTGCAAGGG - Intergenic
1085302873 11:75468617-75468639 CCTCACCAGATGCCGTGCATGGG - Intronic
1088368065 11:109059781-109059803 TCCTCCCATATGCCCTGCACTGG - Intergenic
1089900687 11:121980606-121980628 CCCTTCCAGAAGCCCTACACTGG - Intergenic
1089949173 11:122509629-122509651 CCCCATCACATGCCCTGAAAGGG - Intergenic
1090564302 11:127970484-127970506 CCCCACCAGTTACCTTCCACTGG - Intergenic
1091223861 11:133946351-133946373 CCCCACCAGCTGCCCTCCATGGG + Intronic
1092192533 12:6531432-6531454 CCCTACAGGATACCCTGCACAGG - Exonic
1092569508 12:9707631-9707653 CCCCATCACATGCCCTGCAAGGG + Intergenic
1092782984 12:12004413-12004435 GGCCACCAGATGACCTGCAAAGG - Intergenic
1093654389 12:21677780-21677802 CCCCATCTCATGCCCTGCATGGG + Intronic
1093772058 12:23029721-23029743 CCCCACCAGATGCCAGGGAGAGG - Intergenic
1095820005 12:46467755-46467777 CCTCACAAGATACCTTGCACAGG + Intergenic
1096788365 12:54030479-54030501 CCCCAGCAAATGCCCAGCCCAGG + Exonic
1097029074 12:56079164-56079186 CCCCACCAGCTGCCCGGACCTGG - Intergenic
1098035914 12:66302220-66302242 CCGCAGGAGATGCCGTGCACTGG + Intergenic
1101591516 12:106129376-106129398 ACCCACTAGATGCCTAGCACTGG + Intronic
1101700616 12:107170229-107170251 CCCCACCACATTCCCCTCACTGG - Intergenic
1102012885 12:109629623-109629645 CCCCACCATGTCCCCAGCACCGG + Intergenic
1103942065 12:124506574-124506596 CCACCCGAGAAGCCCTGCACGGG + Intronic
1104052937 12:125208701-125208723 CCCCACCAAAGGCCTTGCAGGGG - Intronic
1104390043 12:128384328-128384350 CCCCTCCAGAGCCCCTGCCCTGG - Intronic
1104888325 12:132125246-132125268 CACCACCACAGGCCCTGCCCGGG + Intronic
1105015929 12:132786866-132786888 CCCCACCAAAGGCACTGCTCAGG + Intronic
1105016273 12:132787920-132787942 CCCCCCCGGATGCCCTCCTCAGG + Intronic
1105682580 13:22744700-22744722 CCCCATCGCATGCCCTGCAAGGG - Intergenic
1110262039 13:73496113-73496135 GCCCACCAGTGGCCCAGCACAGG + Intergenic
1117345059 14:54823364-54823386 CCCCATCAGAGCCCCTGGACTGG - Intergenic
1122059141 14:99124929-99124951 CCCCACCAGAGTCCCTTCAATGG + Intergenic
1122118784 14:99540896-99540918 CCATCCCAGATACCCTGCACTGG + Intronic
1122425058 14:101601052-101601074 CCCGGCCAGATGCTCTGCTCTGG - Intergenic
1122500768 14:102197910-102197932 ACCTACCACATGCCCAGCACTGG + Intronic
1122979405 14:105184931-105184953 CCCCTGCAGATGCCCTGTAGCGG + Intergenic
1122992153 14:105241530-105241552 CCCCACCAGTTCCCCTCCCCTGG + Intronic
1123881202 15:24678480-24678502 CTCCACCAGTTTTCCTGCACAGG + Exonic
1125601534 15:40918323-40918345 CCCCACCCCATGCCCTGGCCAGG - Intergenic
1125754392 15:42053067-42053089 GCCCCCCAGATGCCCCGGACAGG - Intergenic
1126475593 15:49062599-49062621 CCCCATCACATGCCCTGCAAGGG - Intergenic
1129177622 15:73851612-73851634 GCCCACATTATGCCCTGCACAGG + Intergenic
1129674843 15:77626966-77626988 CCCCATCCGCAGCCCTGCACTGG + Intronic
1130149254 15:81298850-81298872 CCCCATCAGAAGCTGTGCACAGG + Intronic
1130325548 15:82876617-82876639 CCCCATCAGATGATCTGAACAGG + Intronic
1130896809 15:88177012-88177034 CCCAAACAGATACCCTGCCCTGG - Intronic
1132091464 15:98950963-98950985 CCCCACCCCATGCCCTCCGCTGG - Intronic
1132335488 15:101045897-101045919 CCCCAGCAGATGGCCTGATCTGG - Intronic
1132731110 16:1362461-1362483 CCCTGCCAGAGGCCCTGCAGCGG + Exonic
1134535942 16:15027231-15027253 CCCCATCACATGCCCTGCGAGGG - Intronic
1136497047 16:30651150-30651172 TCCCACCAGATCCCCTAGACTGG - Intronic
1137702540 16:50507271-50507293 CCCAACCAGGTGCCCAGCACAGG + Intergenic
1137853886 16:51773731-51773753 CCCCAGCGCATGCCCTGCAGGGG + Intergenic
1139302816 16:65959889-65959911 CCCTCCCAGAAGCCCTGCAAAGG + Intergenic
1139860113 16:70013556-70013578 CCCCATCACATGCCCTGCGAGGG + Intergenic
1141038803 16:80654226-80654248 CCCAACCAGAAGCCCAGCCCGGG + Intronic
1141786721 16:86205695-86205717 CCCCACCAGACGCCGTGTCCTGG - Intergenic
1141999550 16:87656381-87656403 CCCCAACAAATGCCATGGACTGG - Intronic
1143684948 17:8506288-8506310 GCCCAGCAGCTGCGCTGCACGGG - Intronic
1143772247 17:9176085-9176107 CCCCACCACCTCCCCTGCAAAGG + Intronic
1145780873 17:27562264-27562286 ACCCACCACATGCCAGGCACTGG - Intronic
1146278405 17:31529868-31529890 CCCGCCCAGATCCCATGCACCGG - Intronic
1146314068 17:31793570-31793592 CCCCACCAGAGGCCCTCTCCAGG - Intergenic
1147045114 17:37745799-37745821 CCCCAGCAGCTGGGCTGCACCGG + Intergenic
1147988718 17:44320721-44320743 CCCCACCCCAAGCCCTGTACTGG - Exonic
1148566437 17:48635677-48635699 CCCCACCAGGTGCCCGGTAGGGG - Intergenic
1148758114 17:49985264-49985286 CCCCACCTCATGCCTAGCACAGG - Intergenic
1150261767 17:63798877-63798899 CCCTTCCACCTGCCCTGCACTGG + Intronic
1151681429 17:75624762-75624784 CCGCACCAGCTGGCCTGCATGGG - Intergenic
1152359780 17:79826519-79826541 CCCCACCCCCTGCCATGCACAGG + Intergenic
1153766063 18:8376170-8376192 CACCACCAGTGGGCCTGCACTGG - Exonic
1155067313 18:22279158-22279180 CCTCAGCAGATGCCCTGTCCTGG + Intergenic
1160239136 18:77110570-77110592 CCACACCACCTGCCTTGCACTGG + Intronic
1160977884 19:1802690-1802712 CCTCCCCAGGTTCCCTGCACCGG + Intronic
1161533733 19:4805848-4805870 ACCCACCAGATCCCCTGAATAGG - Intergenic
1161622639 19:5306724-5306746 CCACCCCAGCTGCCCTTCACTGG - Intronic
1162492725 19:11003480-11003502 CCCCACAAGATGCCCAGCCAGGG - Intronic
1167646800 19:50710430-50710452 CCCCACCAGCTGCCCTTCAAGGG + Intronic
1167864057 19:52309655-52309677 GCCCACCAGAACCCCTGCCCAGG - Intronic
1168199316 19:54803585-54803607 CCTCACCACATCCTCTGCACCGG + Intronic
925092775 2:1168497-1168519 CCCCATCACAAGCCCTGCAAGGG + Intronic
925275636 2:2646072-2646094 ACCCACCAGATGGTCTACACTGG - Intergenic
927154503 2:20213707-20213729 CCCCACCAGGTCCCCTGGAATGG + Intronic
937236337 2:120433733-120433755 CCCCAACAGTTGCCCTGCTTTGG + Intergenic
937318607 2:120947663-120947685 CCCTACCAGGTGCCCGGCCCTGG + Intronic
937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG + Exonic
937854862 2:126664843-126664865 CCCCTGCAGATGCCCAGCCCAGG - Intronic
939818936 2:146931338-146931360 CCACATCACATGCCCTGCAAGGG + Intergenic
946201738 2:218074481-218074503 CCCCACCAGCTTCCAGGCACTGG + Intronic
946345566 2:219107710-219107732 CCATACCACATGCCCTGCTCTGG + Intronic
946397522 2:219450772-219450794 CCCCTCCAGGTGCCTTGCATGGG + Intronic
946408400 2:219504845-219504867 CCTCACCAGCTGCCTTGCTCTGG + Intronic
947740502 2:232482721-232482743 CCCCACCCCATGCCCTGTGCTGG + Intronic
947911358 2:233802962-233802984 CCTCTCCAGGTCCCCTGCACTGG + Intronic
948069328 2:235106968-235106990 CTCCAGGAGATGGCCTGCACTGG + Intergenic
948554977 2:238803078-238803100 CCCCACCTGACTCCCAGCACTGG - Intergenic
948604029 2:239123458-239123480 TCAGACCAGATGCCCAGCACAGG - Intronic
948831572 2:240600912-240600934 CACCATCAGGCGCCCTGCACAGG - Intronic
948869713 2:240791916-240791938 CCCCATCCCAGGCCCTGCACTGG + Intronic
949031421 2:241799166-241799188 CCCCACCATAAGTCCTGCCCCGG + Intronic
1168849012 20:963937-963959 CCCATCCAGAGGCCCTGCCCAGG - Exonic
1169155062 20:3322752-3322774 CCCAAGCAGGTACCCTGCACAGG - Intronic
1170270916 20:14526684-14526706 CCCCACCACATGCCCTGTGAGGG - Intronic
1171183941 20:23111566-23111588 CTCTCCCAGCTGCCCTGCACGGG + Intergenic
1171971687 20:31568933-31568955 CCCTACCACATGCCCTCCTCAGG - Intronic
1172220054 20:33267817-33267839 GCCCTACAGATCCCCTGCACTGG + Intergenic
1173654381 20:44689828-44689850 CCCCTCCAGATGCCAGGCAGGGG + Intergenic
1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG + Intergenic
1175948086 20:62568022-62568044 CCCCAGCAGATGCCCATCTCTGG + Intronic
1176993375 21:15524201-15524223 CCCCACCACACACCCTGCAAGGG + Intergenic
1180892027 22:19296382-19296404 CCCCATCGCATGCCCTGCAAGGG - Intergenic
1183489184 22:38107758-38107780 GCCTACCAGATGCCCTTCCCAGG - Intronic
1183704996 22:39470690-39470712 CCTCACCACATGCCCGGCAGAGG - Intronic
1184113572 22:42409347-42409369 GCCCACCAAACGCCCTGCAGAGG + Intronic
1184800318 22:46754930-46754952 CCTCACCAGATGCCCAGCGGTGG - Intergenic
1185110933 22:48899761-48899783 CCCGGCCAGGTGCCCTGCCCAGG + Intergenic
1185223907 22:49642457-49642479 CGCCACTAGATGCCCAGCCCTGG - Intronic
949309421 3:2679626-2679648 TCCAACCAGATGACCTGCTCAGG - Intronic
949828253 3:8185698-8185720 CCCCATCACACGCCCTGCAAGGG - Intergenic
950649263 3:14396905-14396927 ACAGACCAGATGCCCTGCAGTGG - Intergenic
952756393 3:36871892-36871914 CCCCAACACATGCCCTCTACAGG + Intronic
952886654 3:38016556-38016578 CGCCAGCTGATGCCCAGCACTGG - Exonic
953669105 3:44947804-44947826 CAGCACCAGATGCCCTGGCCTGG + Intronic
954647459 3:52140364-52140386 CCCCACCAGAAAGTCTGCACTGG + Intronic
955486767 3:59442219-59442241 CCCCACCTCATGCACTGCACAGG + Intergenic
956074966 3:65495513-65495535 CCCCAACACATGCCAGGCACTGG + Intronic
956907530 3:73782087-73782109 CCTCTCCAGATGCCCGGAACAGG - Intergenic
957991109 3:87628220-87628242 CCCCATCACATGCCCTGCGAGGG + Intergenic
958923851 3:100136460-100136482 AGCAACCAGATGCCCTGCAGTGG + Intronic
959583504 3:108004815-108004837 CCCCATCACATGCCCTGCGAGGG + Intergenic
960005553 3:112777477-112777499 CCCCAGCAGATGCCCTCCTCTGG - Intronic
962405335 3:135095301-135095323 CCCTACTAGATGCCAGGCACGGG - Intronic
966011736 3:175087253-175087275 CCCGGCCAGCTGCCCTGCCCGGG + Intronic
968942611 4:3646603-3646625 CCCCACCTGGTCCCCAGCACTGG - Intergenic
968957961 4:3728613-3728635 CCCGACCAGGTGCCCTGGGCTGG - Intergenic
968964763 4:3764291-3764313 CACCTCCAGGTGCCCTGGACAGG + Intergenic
969231321 4:5833712-5833734 CCACACCAGATTCCATGCTCAGG - Intronic
969558984 4:7933735-7933757 CCCCAACAGATGGCCAGCAAGGG + Intronic
969629318 4:8326405-8326427 CCTCACCAGAACCCCTGGACAGG + Intergenic
969990190 4:11254068-11254090 CCACACCAGATGTCCAGCAGAGG + Intergenic
972562154 4:40238333-40238355 CTCCACCTGACGCCCTCCACAGG - Intronic
973057393 4:45678456-45678478 CCCCATCACATGCCCTACAAGGG - Intergenic
974333046 4:60504917-60504939 CCACACCACATGACCTGCAGGGG - Intergenic
974669653 4:65013796-65013818 CCCCATCGCATGCCCTGCAAGGG - Intergenic
980577828 4:134708330-134708352 CCCCACCATATGGCCTGTGCAGG + Intergenic
982065253 4:151649450-151649472 CCGCTCCACAGGCCCTGCACAGG - Exonic
984261302 4:177445685-177445707 CCCCATCACACGCCCTGCAAGGG + Intergenic
984461447 4:180041734-180041756 CCCCACCACATTGCCAGCACAGG + Intergenic
985670603 5:1204673-1204695 CCCCCCCAGCTCCTCTGCACAGG + Intronic
985770660 5:1808098-1808120 ACCAACCAGATGACCTGCAAAGG - Intronic
986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG + Intergenic
986617261 5:9631061-9631083 ACCCACCAGATACCCTCCCCAGG + Intronic
990585481 5:57207374-57207396 CCCCATCACATGCCCTGCAAAGG - Intronic
991124413 5:63053279-63053301 GCTCACCAGCTGCCCTGCAAAGG + Intergenic
991196431 5:63939469-63939491 CCCCATCACATGCCCTGCGAGGG + Intergenic
992093670 5:73340749-73340771 CCCCATCACACGCCCTGCAAGGG + Intergenic
992230565 5:74659375-74659397 GCCCTCCACCTGCCCTGCACTGG - Intronic
992308549 5:75468773-75468795 TCACACCAGATGACCTGCCCAGG + Intronic
992660664 5:78957736-78957758 TCCCAACAGATGCCCTGCCTGGG + Intronic
996193179 5:120570398-120570420 AACCGCCAAATGCCCTGCACAGG + Intronic
996855278 5:127998887-127998909 CCTCATCAGAGGCCCTGCGCTGG + Intergenic
998158811 5:139801562-139801584 CCCCAGCACTTGCCCTGCACAGG + Intronic
998310467 5:141124187-141124209 GTCCACCAGATGCCCTGGAAAGG - Exonic
998311624 5:141137623-141137645 GTCCACCAGATGCCCTGGAAAGG - Exonic
998312905 5:141152443-141152465 ATCCACCAGATGCCCTGGAAAGG - Exonic
998313599 5:141158192-141158214 GTCCACCAGATGCCCTGGAAAGG - Intergenic
998315667 5:141180229-141180251 GTCCACCAGATGCCCTGGAAAGG - Exonic
998318071 5:141201966-141201988 GTCCACCAGATGCCCTGGAAAGG - Exonic
998320577 5:141225697-141225719 GTCCACCAGATGCCCTGGAAAGG - Exonic
998322810 5:141247770-141247792 GTCCACCAGATGCCCTGGAAAGG - Exonic
1001279587 5:170377274-170377296 CCACGCCAGAAGCCCTGCACGGG - Exonic
1001314273 5:170631706-170631728 CCCCTCCAGATGCCATCCACTGG + Intronic
1001759148 5:174193160-174193182 CCCCACCAGAGCCCTTGCCCCGG + Intronic
1002060364 5:176622029-176622051 CCCCACATGAGGCACTGCACAGG - Intronic
1003857363 6:10290052-10290074 CCCCAGCAAAGGCCCTGCTCAGG + Intergenic
1004441332 6:15658054-15658076 GTCCACCAGATGCCCTAGACTGG - Intronic
1006092715 6:31637450-31637472 CCCCACCAGATGCCCTGCGCTGG + Exonic
1007151841 6:39701270-39701292 CCCCACGGGAAGCCCTGCTCTGG + Intronic
1007424805 6:41739983-41740005 CCGCCCCAGCTGCCCTGAACTGG - Intronic
1007706377 6:43793816-43793838 CCCCAGCAGATGCCCTCCTGAGG + Intergenic
1008815682 6:55562502-55562524 CACCACCAGTTGCCCTGCCCTGG + Intronic
1010989003 6:82458488-82458510 CTGCACCAGATTCTCTGCACAGG + Intergenic
1012440260 6:99255543-99255565 CCCCATCACATGCCCTGCGAGGG + Intergenic
1013113078 6:107079616-107079638 CCCCATCGCATGCCCTGCAAGGG + Intronic
1014663311 6:124201220-124201242 CCCCACCACATGCCATGGAGAGG - Intronic
1014919443 6:127196048-127196070 CTCAACCAGATGCCCAGGACAGG + Exonic
1016021052 6:139236409-139236431 CCCCATCACATGTCCTGCAATGG + Intergenic
1018265744 6:162023062-162023084 CCCCACCGCATGCCCTGCTAGGG - Intronic
1019257925 7:63492-63514 TCCCACCCGATGGCCTACACTGG - Intergenic
1019432814 7:1007304-1007326 CCCCTGCAGAGGCCCTGGACTGG - Intronic
1019596931 7:1862403-1862425 CCCCACCAGACTTCATGCACAGG - Intronic
1019686321 7:2384048-2384070 CCCCAGCAGATGGCCTGGATTGG - Intergenic
1019918830 7:4150183-4150205 CCTCACCACATGCCCTGACCAGG + Intronic
1022895893 7:34750200-34750222 CCCTACAAGTTACCCTGCACAGG + Intronic
1023044434 7:36198891-36198913 TCCCACCAGCTGCACTGCTCAGG - Intronic
1024379686 7:48681990-48682012 GCTCACCAGCTTCCCTGCACTGG + Intergenic
1025004312 7:55343040-55343062 CTCCACCAGCTTCCCTGCAGGGG - Intergenic
1025606778 7:63045040-63045062 GCCCTCCAGATGCCCTTCTCTGG + Intergenic
1026067669 7:67089371-67089393 CCCCACCAGATGCCCTGCACTGG - Intronic
1026709256 7:72722960-72722982 CCCCACCAGATGCCCTGCACTGG + Intronic
1027932328 7:84553136-84553158 CCCCATCACATGCCCTGCGAGGG + Intergenic
1029903136 7:104063381-104063403 CCCCACCAAATGACAGGCACTGG + Intergenic
1031642328 7:124180408-124180430 CCCCACTACATGCCCTGCTAAGG - Intergenic
1034276226 7:149825000-149825022 CCCTGCCAGGTGCCCTGCAGTGG + Intergenic
1035302117 7:157904378-157904400 CCCCTCCCGTGGCCCTGCACAGG + Intronic
1035418613 7:158709201-158709223 CCCTCACAGCTGCCCTGCACTGG - Intergenic
1038341672 8:26691386-26691408 CCCCACCTGAGGCACTGCACAGG - Intergenic
1039914831 8:41852202-41852224 CCCCACCAGATGCCTTCCCAAGG - Intronic
1040386630 8:46918810-46918832 CCCCACCAGATTCACAGCAGCGG + Intergenic
1044767854 8:95596282-95596304 CCCCACCAGAGGCACAGCAAAGG + Intergenic
1046584998 8:116140373-116140395 CCCAACCAGATGCACTTCTCTGG - Intergenic
1048991488 8:139762935-139762957 CCACTGCACATGCCCTGCACCGG + Intronic
1049047869 8:140166832-140166854 CCACATCTGAAGCCCTGCACTGG + Intronic
1055641373 9:78321108-78321130 CCCCAGGAGATGACCTGCCCAGG - Intronic
1056327421 9:85491276-85491298 CCCCATCACATGCCCTGCGAGGG + Intergenic
1056573225 9:87834445-87834467 CCCCATCACATGCCCTGCGAGGG - Intergenic
1057516357 9:95725252-95725274 CCCCACCAGAGGCACTGCTGTGG - Intergenic
1057843986 9:98507818-98507840 CCCCTCCAGATGCCTAGCACAGG + Intronic
1058041815 9:100310899-100310921 CCCTATTAGATGCCATGCACAGG + Intronic
1058206728 9:102118240-102118262 TCCCATCACATGCCCTGCAAGGG - Intergenic
1058236539 9:102497752-102497774 CCCCATCACATGCCCGGCAAGGG - Intergenic
1059135576 9:111803303-111803325 CCCCACCAGATGTCCTCCGCTGG + Intergenic
1059152127 9:111958535-111958557 TCACACAGGATGCCCTGCACTGG - Intergenic
1060151951 9:121294496-121294518 CCCCTCCAGATGTCCAGCCCTGG + Intronic
1060437242 9:123604533-123604555 CCCCACCACATGCCAGACACTGG + Intronic
1060556802 9:124512200-124512222 CCCCCTCCGCTGCCCTGCACGGG - Intergenic
1060820565 9:126659244-126659266 CCTCACCACCTGCCCAGCACTGG - Intronic
1060881700 9:127122381-127122403 CCCCTCCAGAGGCCATGGACAGG - Exonic
1061163454 9:128909365-128909387 CCCCACCACAAGCCCTGGCCAGG - Intronic
1062261762 9:135666460-135666482 TCCCATCAGATGCCCTTCACAGG + Intergenic
1062359969 9:136183027-136183049 CCCCAGCAGGTGCCCTGGGCTGG + Intergenic
1062406224 9:136397873-136397895 CCACTCCAGAAGCCCTGCACAGG + Intronic
1062437154 9:136551375-136551397 CCCCACCACAGGCTCTGCAGGGG - Intergenic
1062729697 9:138102057-138102079 CCCCAGCAGCAGCCCTGCCCTGG + Intronic
1187963026 X:24584577-24584599 CCCCACCACCAGCCCTGCAGGGG + Intronic
1189344737 X:40232434-40232456 CCCCACCCCCTGCCCTGGACAGG - Intergenic
1189833292 X:44996942-44996964 CCCCATCACATGCCCTGCGAGGG - Intronic
1192892657 X:75407410-75407432 CCCAGCCAGCTGCCCTGCCCAGG + Intronic
1195667000 X:107440755-107440777 CCCCACCATGGGCCCAGCACTGG + Intergenic
1196072361 X:111539694-111539716 CCCCATCACATGCCCTGCGAGGG + Intergenic
1201282263 Y:12352273-12352295 CCCCACCAGCCGCCCTGTCCAGG + Intergenic
1201357800 Y:13114924-13114946 GCCCACCAGAAGTCCTGCACTGG - Intergenic
1202019997 Y:20454148-20454170 CCCCATCACATGCCCTGTAAGGG + Intergenic