ID: 1026067669

View in Genome Browser
Species Human (GRCh38)
Location 7:67089371-67089393
Sequence CCCCACCAGATGCCCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067669_1026067677 12 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067677 7:67089406-67089428 AAAGGTCGAAGCGCTGGGTGCGG No data
1026067669_1026067676 7 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067676 7:67089401-67089423 CTGGTAAAGGTCGAAGCGCTGGG 0: 2
1: 1
2: 1
3: 2
4: 39
1026067669_1026067675 6 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067675 7:67089400-67089422 GCTGGTAAAGGTCGAAGCGCTGG 0: 2
1: 1
2: 2
3: 3
4: 30
1026067669_1026067673 -6 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data
1026067669_1026067678 28 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067669 Original CRISPR CCCCACCAGATGCCCTGCAC TGG (reversed) Intronic