ID: 1026067673

View in Genome Browser
Species Human (GRCh38)
Location 7:67089388-67089410
Sequence GTGGGGAGGCCTGCTGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067658_1026067673 21 Left 1026067658 7:67089344-67089366 CCCTGTCCATTCCCAAGGCTTAG No data
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data
1026067669_1026067673 -6 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data
1026067662_1026067673 10 Left 1026067662 7:67089355-67089377 CCCAAGGCTTAGGTATCCAGTGC No data
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data
1026067659_1026067673 20 Left 1026067659 7:67089345-67089367 CCTGTCCATTCCCAAGGCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data
1026067661_1026067673 15 Left 1026067661 7:67089350-67089372 CCATTCCCAAGGCTTAGGTATCC No data
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data
1026067663_1026067673 9 Left 1026067663 7:67089356-67089378 CCAAGGCTTAGGTATCCAGTGCA 0: 2
1: 1
2: 0
3: 11
4: 110
Right 1026067673 7:67089388-67089410 GTGGGGAGGCCTGCTGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067673 Original CRISPR GTGGGGAGGCCTGCTGGTAA AGG Intronic