ID: 1026067674

View in Genome Browser
Species Human (GRCh38)
Location 7:67089397-67089419
Sequence GCGCTTCGACCTTTACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 2, 1: 1, 2: 1, 3: 0, 4: 22}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067674_1026067683 26 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067683 7:67089446-67089468 GGAAGGCGTGGCCTTGAGACAGG No data
1026067674_1026067678 2 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65
1026067674_1026067680 9 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067680 7:67089429-67089451 AAGACTCCACTGCAGGTGGAAGG 0: 2
1: 1
2: 2
3: 17
4: 211
1026067674_1026067679 5 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067679 7:67089425-67089447 GCGGAAGACTCCACTGCAGGTGG 0: 1
1: 2
2: 2
3: 9
4: 113
1026067674_1026067681 14 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067681 7:67089434-67089456 TCCACTGCAGGTGGAAGGCGTGG 0: 1
1: 2
2: 2
3: 30
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067674 Original CRISPR GCGCTTCGACCTTTACCAGC AGG (reversed) Intronic
913206017 1:116539661-116539683 GCACTTCTACCTTTGCCATCTGG - Intronic
1073660556 10:105471576-105471598 GAGCTTTCAGCTTTACCAGCAGG - Intergenic
1095170994 12:39036288-39036310 GTGCTACGACCTCTACCACCTGG - Intergenic
1115755349 14:36522616-36522638 GCGCTTCAACCTCTGCCTGCAGG + Intergenic
1129316844 15:74750290-74750312 GCACTTCGACCCTTACAATCAGG + Exonic
1136238928 16:28932533-28932555 GGGCTTCTACCTGTGCCAGCCGG + Exonic
1151685767 17:75645875-75645897 GCTCCTAGATCTTTACCAGCTGG + Intronic
1165904869 19:39187629-39187651 GCCCTTCCCCCTCTACCAGCAGG + Intergenic
932614622 2:73224037-73224059 GCGCTTCTGCCTTTGCCAGGTGG + Intronic
943374241 2:187055277-187055299 GTGCTGCCACCTTCACCAGCTGG + Intergenic
947385580 2:229587287-229587309 CAGCTTCGAGCTCTACCAGCAGG - Intronic
1170075808 20:12417592-12417614 GAGCTTTGACCTTTCCCAGGAGG - Intergenic
1173803202 20:45907840-45907862 GCGCTTCCTCCTCAACCAGCAGG - Exonic
951844119 3:27067106-27067128 GCGCTTCAGACTTTACCAGATGG + Intergenic
969648961 4:8452022-8452044 TCGCTTACACCCTTACCAGCAGG - Exonic
995509480 5:112893762-112893784 GTGCTTGGACCTTTAACAGAAGG - Intronic
1001043945 5:168356804-168356826 GCGCTTCTCCAGTTACCAGCTGG + Intronic
1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG + Exonic
1007217069 6:40248559-40248581 GAGCTTTTACCTTTAACAGCCGG + Intergenic
1026067674 7:67089397-67089419 GCGCTTCGACCTTTACCAGCAGG - Intronic
1026709251 7:72722934-72722956 GCGCTTCGACCTTTACCAGCAGG + Intronic
1030922453 7:115408608-115408630 CTGCTTGGACCTTTATCAGCAGG - Intergenic
1033911775 7:146272517-146272539 GTGCTTGGACTTCTACCAGCGGG - Intronic
1053480394 9:38412529-38412551 CACCTTCTACCTTTACCAGCGGG + Intronic
1059135571 9:111803277-111803299 GCGCATCGACCTTCACCAGCAGG + Intergenic
1059435087 9:114271215-114271237 ACGCTAAGCCCTTTACCAGCTGG + Intronic