ID: 1026067674

View in Genome Browser
Species Human (GRCh38)
Location 7:67089397-67089419
Sequence GCGCTTCGACCTTTACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 2, 1: 1, 2: 1, 3: 0, 4: 22}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067674_1026067681 14 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067681 7:67089434-67089456 TCCACTGCAGGTGGAAGGCGTGG 0: 1
1: 2
2: 2
3: 30
4: 205
1026067674_1026067680 9 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067680 7:67089429-67089451 AAGACTCCACTGCAGGTGGAAGG 0: 2
1: 1
2: 2
3: 17
4: 211
1026067674_1026067678 2 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG 0: 1
1: 2
2: 0
3: 6
4: 65
1026067674_1026067683 26 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067683 7:67089446-67089468 GGAAGGCGTGGCCTTGAGACAGG No data
1026067674_1026067679 5 Left 1026067674 7:67089397-67089419 CCTGCTGGTAAAGGTCGAAGCGC 0: 2
1: 1
2: 1
3: 0
4: 22
Right 1026067679 7:67089425-67089447 GCGGAAGACTCCACTGCAGGTGG 0: 1
1: 2
2: 2
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067674 Original CRISPR GCGCTTCGACCTTTACCAGC AGG (reversed) Intronic