ID: 1026067675

View in Genome Browser
Species Human (GRCh38)
Location 7:67089400-67089422
Sequence GCTGGTAAAGGTCGAAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 2, 1: 1, 2: 2, 3: 3, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067663_1026067675 21 Left 1026067663 7:67089356-67089378 CCAAGGCTTAGGTATCCAGTGCA 0: 2
1: 1
2: 0
3: 11
4: 110
Right 1026067675 7:67089400-67089422 GCTGGTAAAGGTCGAAGCGCTGG 0: 2
1: 1
2: 2
3: 3
4: 30
1026067661_1026067675 27 Left 1026067661 7:67089350-67089372 CCATTCCCAAGGCTTAGGTATCC No data
Right 1026067675 7:67089400-67089422 GCTGGTAAAGGTCGAAGCGCTGG 0: 2
1: 1
2: 2
3: 3
4: 30
1026067669_1026067675 6 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067675 7:67089400-67089422 GCTGGTAAAGGTCGAAGCGCTGG 0: 2
1: 1
2: 2
3: 3
4: 30
1026067662_1026067675 22 Left 1026067662 7:67089355-67089377 CCCAAGGCTTAGGTATCCAGTGC No data
Right 1026067675 7:67089400-67089422 GCTGGTAAAGGTCGAAGCGCTGG 0: 2
1: 1
2: 2
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067675 Original CRISPR GCTGGTAAAGGTCGAAGCGC TGG Intronic