ID: 1026067677

View in Genome Browser
Species Human (GRCh38)
Location 7:67089406-67089428
Sequence AAAGGTCGAAGCGCTGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026067662_1026067677 28 Left 1026067662 7:67089355-67089377 CCCAAGGCTTAGGTATCCAGTGC No data
Right 1026067677 7:67089406-67089428 AAAGGTCGAAGCGCTGGGTGCGG No data
1026067663_1026067677 27 Left 1026067663 7:67089356-67089378 CCAAGGCTTAGGTATCCAGTGCA 0: 2
1: 1
2: 0
3: 11
4: 110
Right 1026067677 7:67089406-67089428 AAAGGTCGAAGCGCTGGGTGCGG No data
1026067669_1026067677 12 Left 1026067669 7:67089371-67089393 CCAGTGCAGGGCATCTGGTGGGG No data
Right 1026067677 7:67089406-67089428 AAAGGTCGAAGCGCTGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026067677 Original CRISPR AAAGGTCGAAGCGCTGGGTG CGG Intronic