ID: 1026067677 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:67089406-67089428 |
| Sequence | AAAGGTCGAAGCGCTGGGTG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1026067662_1026067677 | 28 | Left | 1026067662 | 7:67089355-67089377 | CCCAAGGCTTAGGTATCCAGTGC | No data | ||
| Right | 1026067677 | 7:67089406-67089428 | AAAGGTCGAAGCGCTGGGTGCGG | No data | ||||
| 1026067663_1026067677 | 27 | Left | 1026067663 | 7:67089356-67089378 | CCAAGGCTTAGGTATCCAGTGCA | 0: 2 1: 1 2: 0 3: 11 4: 110 |
||
| Right | 1026067677 | 7:67089406-67089428 | AAAGGTCGAAGCGCTGGGTGCGG | No data | ||||
| 1026067669_1026067677 | 12 | Left | 1026067669 | 7:67089371-67089393 | CCAGTGCAGGGCATCTGGTGGGG | No data | ||
| Right | 1026067677 | 7:67089406-67089428 | AAAGGTCGAAGCGCTGGGTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1026067677 | Original CRISPR | AAAGGTCGAAGCGCTGGGTG CGG | Intronic | ||